Transcript: Human XR_001749531.1

PREDICTED: Homo sapiens zinc finger DHHC-type containing 20 (ZDHHC20), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZDHHC20 (253832)
Length:
5406
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001749531.1
NBCI Gene record:
ZDHHC20 (253832)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001749531.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125165 CCGTTGTTTACCTTGTGGCTT pLKO.1 290 3UTR 100% 2.640 3.696 N Zdhhc20 n/a
2 TRCN0000139390 CCGTTGTTTACCTTGTGGCTT pLKO.1 290 3UTR 100% 2.640 3.696 N ZDHHC20 n/a
3 TRCN0000144807 GCAGAATGATGCCTTAATCTT pLKO.1 1474 3UTR 100% 5.625 4.500 N ZDHHC20 n/a
4 TRCN0000144894 GCATTGACTTAGAGCTACAAA pLKO.1 1512 3UTR 100% 5.625 4.500 N ZDHHC20 n/a
5 TRCN0000125168 CCATCTGTTCTTTGTTATGTT pLKO.1 312 3UTR 100% 5.625 3.938 N Zdhhc20 n/a
6 TRCN0000140682 CTCAGCCTGTGACTCATGTAT pLKO.1 564 3UTR 100% 5.625 3.938 N ZDHHC20 n/a
7 TRCN0000144009 CTTTGTGTCTGCAATGTTCTT pLKO.1 780 3UTR 100% 4.950 3.465 N ZDHHC20 n/a
8 TRCN0000139310 CCAGAGCAGAATGATGCCTTA pLKO.1 1469 3UTR 100% 4.050 2.835 N ZDHHC20 n/a
9 TRCN0000143946 CAAAGAGTTCTACTTGTCCAA pLKO.1 381 3UTR 100% 2.640 1.848 N ZDHHC20 n/a
10 TRCN0000078412 CGTGGTCGTCTGGTCCTACTA pLKO.1 210 3UTR 100% 1.650 1.155 N MTHFD2L n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3463 3UTR 100% 13.200 6.600 Y LIAS n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3083 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3083 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001749531.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13454 pDONR223 100% 17.7% None 1_138del;1099_5406del n/a
2 ccsbBroad304_13454 pLX_304 0% 17.7% V5 1_138del;1099_5406del n/a
3 TRCN0000480184 TCAAACCCCGATCCACCTAGCGGA pLX_317 43.3% 17.7% V5 1_138del;1099_5406del n/a
4 ccsbBroadEn_16134 pDONR223 0% 7% None (many diffs) n/a
5 ccsbBroad304_16134 pLX_304 0% 7% V5 (many diffs) n/a
6 TRCN0000467481 CCATACTTCGACACTAGACACCGT pLX_317 76.5% 7% V5 (many diffs) n/a
Download CSV