Transcript: Human XR_001749634.1

PREDICTED: Homo sapiens SPRY domain containing 7 (SPRYD7), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPRYD7 (57213)
Length:
3347
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001749634.1
NBCI Gene record:
SPRYD7 (57213)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001749634.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072714 GCCCTTTACCACAACAATGAA pLKO.1 585 3UTR 100% 5.625 7.875 N SPRYD7 n/a
2 TRCN0000072717 CTTATGACCATGTCGAATTAA pLKO.1 664 3UTR 100% 15.000 12.000 N SPRYD7 n/a
3 TRCN0000300086 CTTATGACCATGTCGAATTAA pLKO_005 664 3UTR 100% 15.000 12.000 N SPRYD7 n/a
4 TRCN0000303807 GTTGCAACTCAGAAGGTTAAC pLKO_005 507 3UTR 100% 10.800 8.640 N SPRYD7 n/a
5 TRCN0000303806 CACCCTGAAGTTGTGATTTAA pLKO_005 1131 3UTR 100% 15.000 10.500 N SPRYD7 n/a
6 TRCN0000303808 GACAGTGTATCCAGTTGTTTA pLKO_005 737 3UTR 100% 13.200 9.240 N SPRYD7 n/a
7 TRCN0000072716 CCAGCGCACCTTTACATCAAA pLKO.1 433 3UTR 100% 5.625 3.938 N SPRYD7 n/a
8 TRCN0000072713 CCCTCCTTTATCAACTAGAAA pLKO.1 2012 3UTR 100% 5.625 3.938 N SPRYD7 n/a
9 TRCN0000072715 CACAGTCTGGTGATGAGAAAT pLKO.1 558 3UTR 100% 13.200 7.920 N SPRYD7 n/a
10 TRCN0000303805 TGTGGAACAGGAGGTTGTTTA pLKO_005 411 3UTR 100% 13.200 7.920 N SPRYD7 n/a
11 TRCN0000204533 CCTCCCAAAGTGCTGGAATTA pLKO.1 2864 3UTR 100% 13.200 6.600 Y LRRC74B n/a
12 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 2243 3UTR 100% 4.950 2.475 Y CFLAR n/a
13 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 2243 3UTR 100% 4.950 2.475 Y C19orf31 n/a
14 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 2241 3UTR 100% 4.950 2.475 Y ERN2 n/a
15 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 2241 3UTR 100% 4.950 2.475 Y P3H4 n/a
16 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 2241 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001749634.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08717 pDONR223 100% 14% None (many diffs) n/a
2 TRCN0000470473 TTCATAAACATATGGGTGTCTATC pLX_317 85.5% 14% V5 (many diffs) n/a
Download CSV