Transcript: Human XR_001750155.1

PREDICTED: Homo sapiens solute carrier family 25 member 29 (SLC25A29), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC25A29 (123096)
Length:
4378
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001750155.1
NBCI Gene record:
SLC25A29 (123096)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001750155.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245277 CTGAGGCCATTGCACCGTTAT pLKO_005 1644 3UTR 100% 10.800 15.120 N SLC25A29 n/a
2 TRCN0000245273 CCGTTTGACACGGTCAAGGTA pLKO_005 522 3UTR 100% 3.000 4.200 N SLC25A29 n/a
3 TRCN0000044777 GCGGTACGTCAGGCATCGTGT pLKO.1 1048 3UTR 100% 0.000 0.000 N SLC25A29 n/a
4 TRCN0000245274 GGACGTTGCACTGCTTCAAGT pLKO_005 583 3UTR 100% 4.950 3.960 N SLC25A29 n/a
5 TRCN0000044774 GCGCACCTACAAGGGCTCGCT pLKO.1 845 3UTR 100% 0.000 0.000 N SLC25A29 n/a
6 TRCN0000245275 GCGTCTACTTCCTCACCTATG pLKO_005 958 3UTR 100% 6.000 4.200 N SLC25A29 n/a
7 TRCN0000245276 TGTCCTGGCTCTCTACCTATC pLKO_005 1066 3UTR 100% 6.000 4.200 N SLC25A29 n/a
8 TRCN0000044776 CTGGCTCTCTACCTATCCTGT pLKO.1 1070 3UTR 100% 2.640 1.848 N SLC25A29 n/a
9 TRCN0000044775 CTCAACCAGTTCCTGGCAGGT pLKO.1 738 3UTR 100% 0.720 0.504 N SLC25A29 n/a
10 TRCN0000044773 GCTGCGTGAGACGCCCAGCTT pLKO.1 935 3UTR 100% 0.000 0.000 N SLC25A29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001750155.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13094 pDONR223 100% 16.2% None 1_659del;1371_4378del n/a
2 ccsbBroad304_13094 pLX_304 0% 16.2% V5 1_659del;1371_4378del n/a
3 TRCN0000476991 TGTCGTGCTATGACCAACGATATA pLX_317 21.3% 16.2% V5 1_659del;1371_4378del n/a
Download CSV