Transcript: Human XR_001750190.1

PREDICTED: Homo sapiens vasohibin 1 (VASH1), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VASH1 (22846)
Length:
7966
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001750190.1
NBCI Gene record:
VASH1 (22846)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001750190.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373847 CAACTGAAGTTTAAGGTATTT pLKO_005 4196 3UTR 100% 13.200 10.560 N VASH1 n/a
2 TRCN0000373930 GGCCTAGAGGCCGTTAGTATT pLKO_005 4153 3UTR 100% 13.200 9.240 N VASH1 n/a
3 TRCN0000139334 CACAGGACATAGTGGTGCTTT pLKO.1 6673 3UTR 100% 4.950 3.465 N VASH1 n/a
4 TRCN0000139620 CTGCCAATCAAATGCCTGGAA pLKO.1 1858 3UTR 100% 2.640 1.848 N VASH1 n/a
5 TRCN0000144795 GAAATTAAGAAGAGCAGACCT pLKO.1 1792 3UTR 100% 2.640 1.848 N VASH1 n/a
6 TRCN0000373848 CAAAGCCATGCCAGACCTTAA pLKO_005 3925 3UTR 100% 10.800 6.480 N VASH1 n/a
7 TRCN0000139710 CCTACTTCTCAGGGAACTACT pLKO.1 3453 3UTR 100% 4.950 2.970 N VASH1 n/a
8 TRCN0000140443 GAGCTGCAGTACAATCACACA pLKO.1 1756 3UTR 100% 2.640 1.584 N VASH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001750190.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02692 pDONR223 100% 13.7% None 1_1365del;1895_3398del;3965_7966del n/a
2 ccsbBroad304_02692 pLX_304 0% 13.7% V5 1_1365del;1895_3398del;3965_7966del n/a
3 TRCN0000466840 GGAAAGCAACCCCCCTCCGTTCAG pLX_317 33% 13.7% V5 1_1365del;1895_3398del;3965_7966del n/a
4 ccsbBroadEn_11634 pDONR223 100% 7.6% None (many diffs) n/a
5 ccsbBroad304_11634 pLX_304 0% 7.6% V5 (many diffs) n/a
6 TRCN0000475048 GTCCGATGCATTTCAGATAGATCT pLX_317 18.6% 7.6% V5 (many diffs) n/a
Download CSV