Transcript: Human XR_001750377.1

PREDICTED: Homo sapiens DNA polymerase epsilon 2, accessory subunit (POLE2), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
POLE2 (5427)
Length:
2415
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001750377.1
NBCI Gene record:
POLE2 (5427)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001750377.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233181 AGATGTTTCGTGAGCGATATA pLKO_005 394 3UTR 100% 13.200 18.480 N POLE2 n/a
2 TRCN0000233183 GTCCAACTAGACCTTAGTAAA pLKO_005 621 3UTR 100% 13.200 18.480 N POLE2 n/a
3 TRCN0000052987 GCATTTGATATTCCACGCTTT pLKO.1 282 3UTR 100% 4.050 5.670 N POLE2 n/a
4 TRCN0000052986 CCGTGAAGACTTAGTAAATAA pLKO.1 1256 3UTR 100% 15.000 12.000 N POLE2 n/a
5 TRCN0000233184 TCCGTGAAGACTTAGTAAATA pLKO_005 1255 3UTR 100% 15.000 10.500 N POLE2 n/a
6 TRCN0000233182 TTGGAATGATAACGCAGTTAA pLKO_005 562 3UTR 100% 13.200 9.240 N POLE2 n/a
7 TRCN0000052983 CGCATAATGTTTGCTGGTTAT pLKO.1 924 3UTR 100% 10.800 7.560 N POLE2 n/a
8 TRCN0000052984 GCGATTGTTCTTGGAATGATA pLKO.1 552 3UTR 100% 5.625 3.938 N POLE2 n/a
9 TRCN0000052985 GCTATTAAGTACCTCACAGAA pLKO.1 84 3UTR 100% 4.950 3.465 N POLE2 n/a
10 TRCN0000233180 GCTCCGTGGTGAAGCTATTAA pLKO_005 71 3UTR 100% 15.000 9.000 N POLE2 n/a
11 TRCN0000180546 GCCTGTAATCCCAGGACTTTA pLKO.1 2269 3UTR 100% 13.200 6.600 Y PRR11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001750377.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01236 pDONR223 100% 65.2% None (many diffs) n/a
2 ccsbBroad304_01236 pLX_304 0% 65.2% V5 (many diffs) n/a
3 TRCN0000474915 GGCCCGATAGCTATAACCCTCTGA pLX_317 37.4% 65.2% V5 (many diffs) n/a
4 ccsbBroadEn_06748 pDONR223 100% 62.2% None (many diffs) n/a
5 ccsbBroad304_06748 pLX_304 0% 62.2% V5 (many diffs) n/a
6 TRCN0000477166 CCATGAACGTACAGCCCCGTAACT pLX_317 27.6% 62.2% V5 (many diffs) n/a
Download CSV