Transcript: Human XR_001750463.1

PREDICTED: Homo sapiens thioredoxin domain containing 16 (TXNDC16), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TXNDC16 (57544)
Length:
4776
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001750463.1
NBCI Gene record:
TXNDC16 (57544)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001750463.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378753 TACTTCCGAGTAGCCATATTT pLKO_005 3391 3UTR 100% 15.000 21.000 N TXNDC16 n/a
2 TRCN0000064170 CCTATATTGATGTGGCAGTTA pLKO.1 1712 3UTR 100% 4.950 6.930 N TXNDC16 n/a
3 TRCN0000372682 TGTCAGTATTGGGACTATTTA pLKO_005 2009 3UTR 100% 15.000 12.000 N TXNDC16 n/a
4 TRCN0000064171 CCGATTGAAACTCTGAGAATA pLKO.1 2959 3UTR 100% 13.200 10.560 N TXNDC16 n/a
5 TRCN0000064168 GCACTGTAAATCCTCAGTATA pLKO.1 2504 3UTR 100% 13.200 9.240 N TXNDC16 n/a
6 TRCN0000064172 CCAGCTCAACAGGATTTCATA pLKO.1 1905 3UTR 100% 5.625 3.938 N TXNDC16 n/a
7 TRCN0000064169 GCCAAGGTTAATTGTGTCAAA pLKO.1 667 3UTR 100% 4.950 3.465 N TXNDC16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001750463.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08743 pDONR223 100% 51.7% None (many diffs) n/a
2 ccsbBroad304_08743 pLX_304 0% 51.7% V5 (many diffs) n/a
3 TRCN0000476741 AGGCGGAGGATTTCAAATCTTCTC pLX_317 13.6% 51.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV