Transcript: Human XR_001751051.1

PREDICTED: Homo sapiens calcium and integrin binding family member 2 (CIB2), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CIB2 (10518)
Length:
2112
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001751051.1
NBCI Gene record:
CIB2 (10518)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001751051.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039596 CGAGAGCTCAAGGCAAACTAT pLKO.1 1198 3UTR 100% 5.625 7.875 N CIB2 n/a
2 TRCN0000332967 CGAGAGCTCAAGGCAAACTAT pLKO_005 1198 3UTR 100% 5.625 7.875 N CIB2 n/a
3 TRCN0000039597 GAACCTCACTTTCAACGACTT pLKO.1 1140 3UTR 100% 4.050 3.240 N CIB2 n/a
4 TRCN0000039593 GTCCTTTCCTACTCCAGAAAT pLKO.1 1717 3UTR 100% 13.200 9.240 N CIB2 n/a
5 TRCN0000332968 GTCCTTTCCTACTCCAGAAAT pLKO_005 1717 3UTR 100% 13.200 9.240 N CIB2 n/a
6 TRCN0000018334 CTGACTTCGAGGACATGATTG pLKO.1 1388 3UTR 100% 10.800 7.560 N CIB2 n/a
7 TRCN0000344569 CTGACTTCGAGGACATGATTG pLKO_005 1388 3UTR 100% 10.800 7.560 N CIB2 n/a
8 TRCN0000039594 GCTGACTTCGAGGACATGATT pLKO.1 1387 3UTR 100% 5.625 3.938 N CIB2 n/a
9 TRCN0000010367 CAACTACCAGGACTGCACCTT pLKO.1 803 3UTR 100% 2.640 1.848 N CIB2 n/a
10 TRCN0000104786 CAAGGCAAACTATGCCTTCAA pLKO.1 1206 3UTR 100% 0.495 0.347 N Cib2 n/a
11 TRCN0000010368 CCTCCTTCACAATGTGAAGCT pLKO.1 1944 3UTR 100% 0.264 0.185 N CIB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001751051.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07627 pDONR223 100% 26.5% None (many diffs) n/a
2 ccsbBroad304_07627 pLX_304 0% 26.5% V5 (many diffs) n/a
3 TRCN0000473152 CAACACTATTGGGCCTTTGGGCAC pLX_317 77.2% 26.5% V5 (many diffs) n/a
4 ccsbBroadEn_14049 pDONR223 100% 20.4% None (many diffs) n/a
5 ccsbBroad304_14049 pLX_304 0% 20.4% V5 (many diffs) n/a
6 TRCN0000474105 ACATTCCCCCCTCAATTCTAAAAC pLX_317 61% 20.4% V5 (many diffs) n/a
Download CSV