Transcript: Human XR_001751188.2

PREDICTED: Homo sapiens cyclin D1 binding protein 1 (CCNDBP1), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCNDBP1 (23582)
Length:
1713
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001751188.2
NBCI Gene record:
CCNDBP1 (23582)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001751188.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432498 GACGATCAAGAGCTCATAATC pLKO_005 922 3UTR 100% 13.200 10.560 N CCNDBP1 n/a
2 TRCN0000421822 GATGTTGATGGTCTCAATAAA pLKO_005 1670 3UTR 100% 15.000 10.500 N CCNDBP1 n/a
3 TRCN0000415591 GATTTGGCTCTGAGCATATAT pLKO_005 1084 3UTR 100% 15.000 10.500 N CCNDBP1 n/a
4 TRCN0000045208 CCTGAGAACAATGACCTTATT pLKO.1 646 3UTR 100% 13.200 9.240 N CCNDBP1 n/a
5 TRCN0000045212 CCCAGCAATCAGGACTTGTAT pLKO.1 892 3UTR 100% 5.625 3.938 N CCNDBP1 n/a
6 TRCN0000045210 CGAGGAGTTTAATCGAGAGAT pLKO.1 348 3UTR 100% 4.950 3.465 N CCNDBP1 n/a
7 TRCN0000045211 CGGATGTTAGTGGCAGAGAAT pLKO.1 991 3UTR 100% 4.950 3.465 N CCNDBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001751188.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02802 pDONR223 100% 63% None 1_216del;1138_1194del;1354_1713del n/a
2 ccsbBroad304_02802 pLX_304 0% 63% V5 1_216del;1138_1194del;1354_1713del n/a
3 TRCN0000465921 TGATCCCCCGCCACATTGAGGCCC pLX_317 29.8% 63% V5 1_216del;1138_1194del;1354_1713del n/a
Download CSV