Transcript: Human XR_001751323.2

PREDICTED: Homo sapiens MINDY lysine 48 deubiquitinase 2 (MINDY2), transcript variant X10, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MINDY2 (54629)
Length:
1862
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001751323.2
NBCI Gene record:
MINDY2 (54629)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001751323.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144588 GAGATTACATGCTTGATGCAA pLKO.1 1037 3UTR 100% 3.000 4.200 N MINDY2 n/a
2 TRCN0000140448 GAGTCGTTCTCTAACCTGCAT pLKO.1 667 3UTR 100% 2.640 3.696 N MINDY2 n/a
3 TRCN0000142964 CCACCGATGATGGAAATCATA pLKO.1 988 3UTR 100% 0.563 0.788 N MINDY2 n/a
4 TRCN0000283390 TGTGTGTTCTTTCGGAATAAT pLKO_005 1356 3UTR 100% 15.000 10.500 N Mindy2 n/a
5 TRCN0000139925 GATCCAGTGGAAGGAAGAGAA pLKO.1 879 3UTR 100% 4.950 3.465 N MINDY2 n/a
6 TRCN0000142735 CATGCTTGATGCAAAGCCAAA pLKO.1 1044 3UTR 100% 4.050 2.835 N MINDY2 n/a
7 TRCN0000139982 GAAGGAAGAGAACACACCCAT pLKO.1 888 3UTR 100% 2.640 1.848 N MINDY2 n/a
8 TRCN0000143316 GCAAAGAAACTCCAAGAGGAA pLKO.1 1671 3UTR 100% 2.640 1.848 N MINDY2 n/a
9 TRCN0000145035 GCTTCTCAATACTATCAGGAA pLKO.1 1704 3UTR 100% 2.640 1.848 N MINDY2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001751323.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12068 pDONR223 100% 58.9% None (many diffs) n/a
2 ccsbBroad304_12068 pLX_304 0% 58.9% V5 (many diffs) n/a
3 TRCN0000474250 TATTTAGCACGCGCTCTCCGTACT pLX_317 35% 58.9% V5 (many diffs) n/a
Download CSV