Transcript: Human XR_001752145.2

PREDICTED: Homo sapiens uncharacterized LOC102724859 (LOC102724859), transcript variant X7, ncRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC102724859 (102724859)
Length:
22126
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001752145.2
NBCI Gene record:
LOC102724859 (102724859)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001752145.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 16735 3UTR 100% 4.950 2.475 Y CFLAR n/a
2 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 16735 3UTR 100% 4.950 2.475 Y C19orf31 n/a
3 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 15369 3UTR 100% 0.495 0.248 Y C11orf44 n/a
4 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 16733 3UTR 100% 4.950 2.475 Y ERN2 n/a
5 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 16733 3UTR 100% 4.950 2.475 Y P3H4 n/a
6 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 16733 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001752145.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10792 pDONR223 100% .9% None (many diffs) n/a
2 ccsbBroad304_10792 pLX_304 0% .9% V5 (many diffs) n/a
3 TRCN0000472287 GCCTGGAGAGCTTTCCTCGTCACG pLX_317 100% .9% V5 (many diffs) n/a
Download CSV