Transcript: Human XR_001752478.2

PREDICTED: Homo sapiens HID1 domain containing (HID1), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HID1 (283987)
Length:
3843
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001752478.2
NBCI Gene record:
HID1 (283987)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001752478.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135413 GCTGAACAAACCCTACTCAAT pLKO.1 1421 3UTR 100% 4.950 6.930 N HID1 n/a
2 TRCN0000125423 CCAGTACCAGTTTGATGGCAA pLKO.1 1727 3UTR 100% 2.640 3.432 N Hid1 n/a
3 TRCN0000322576 GCCTAACTACATCCACGATAT pLKO_005 692 3UTR 100% 10.800 8.640 N HID1 n/a
4 TRCN0000137059 CGACGTGAAGCTGTTTGAGAT pLKO.1 2982 3UTR 100% 4.950 3.960 N HID1 n/a
5 TRCN0000134164 CCACCATTCTGAGCTTTAAAT pLKO.1 3082 3UTR 100% 15.000 10.500 N HID1 n/a
6 TRCN0000322646 CCACCATTCTGAGCTTTAAAT pLKO_005 3082 3UTR 100% 15.000 10.500 N HID1 n/a
7 TRCN0000136722 CCCTGAGAACCTGTTTGTGAA pLKO.1 1067 3UTR 100% 4.950 3.465 N HID1 n/a
8 TRCN0000322644 CCCTGAGAACCTGTTTGTGAA pLKO_005 1067 3UTR 100% 4.950 3.465 N HID1 n/a
9 TRCN0000137327 GCTCTGCGACTTCAACAAGAA pLKO.1 1238 3UTR 100% 4.950 3.465 N HID1 n/a
10 TRCN0000322574 GCTCTGCGACTTCAACAAGAA pLKO_005 1238 3UTR 100% 4.950 3.465 N HID1 n/a
11 TRCN0000136839 CCAGTTCATCCTCAAGGGTAT pLKO.1 1121 3UTR 100% 4.050 2.835 N HID1 n/a
12 TRCN0000134882 CTTCAACAACATCATCCAGTA pLKO.1 1712 3UTR 100% 4.050 2.835 N HID1 n/a
13 TRCN0000125422 CAGTACCAGTTTGATGGCAAT pLKO.1 1728 3UTR 100% 4.050 5.265 N Hid1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001752478.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09949 pDONR223 100% 61.4% None (many diffs) n/a
2 ccsbBroad304_09949 pLX_304 0% 61.4% V5 (many diffs) n/a
3 TRCN0000491361 ACCGCTAGATCAATTTGGGCTTGA pLX_317 13.5% 61.4% V5 (many diffs) n/a
Download CSV