Transcript: Human XR_001752498.1

PREDICTED: Homo sapiens solute carrier family 26 member 11 (SLC26A11), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC26A11 (284129)
Length:
1212
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001752498.1
NBCI Gene record:
SLC26A11 (284129)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001752498.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417722 CCCGTCATTAAAGGCTTCACC pLKO_005 749 3UTR 100% 2.640 3.696 N SLC26A11 n/a
2 TRCN0000418726 TTGCGTACTCCTTCGAGGTGA pLKO_005 1183 3UTR 100% 2.640 3.696 N SLC26A11 n/a
3 TRCN0000044901 GCAGTGGCTGAAGATGGATTT pLKO.1 358 3UTR 100% 10.800 7.560 N SLC26A11 n/a
4 TRCN0000425173 ACCACACCTTCCTCAGGATTG pLKO_005 858 3UTR 100% 6.000 4.200 N SLC26A11 n/a
5 TRCN0000044899 CCTGCTGGACTTCATTTCCTA pLKO.1 727 3UTR 100% 3.000 2.100 N SLC26A11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001752498.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13519 pDONR223 100% 33.7% None (many diffs) n/a
2 ccsbBroad304_13519 pLX_304 0% 33.7% V5 (many diffs) n/a
3 TRCN0000478298 ACTATCTATAGAGAGGTACGGGAC pLX_317 18.1% 33.7% V5 (many diffs) n/a
Download CSV