Transcript: Human XR_001752579.2

PREDICTED: Homo sapiens arachidonate lipoxygenase 3 (ALOXE3), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ALOXE3 (59344)
Length:
3014
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001752579.2
NBCI Gene record:
ALOXE3 (59344)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001752579.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056654 CCTTGACAAAGACGACAACTT pLKO.1 788 3UTR 100% 4.950 3.960 N ALOXE3 n/a
2 TRCN0000414017 ACCAAAGTCCAATGCACAATA pLKO_005 2507 3UTR 100% 13.200 9.240 N ALOXE3 n/a
3 TRCN0000056655 CCACTTCACCTACACCAATTT pLKO.1 1719 3UTR 100% 13.200 9.240 N ALOXE3 n/a
4 TRCN0000056656 GCACTTTCTGTGCACGCATTT pLKO.1 1494 3UTR 100% 10.800 7.560 N ALOXE3 n/a
5 TRCN0000067987 CCAGTACCTGAATGGTGTCAA pLKO.1 1101 3UTR 100% 4.950 3.465 N Aloxe3 n/a
6 TRCN0000056653 CCTCACTGCAATCATCTTCAA pLKO.1 1879 3UTR 100% 4.950 3.465 N ALOXE3 n/a
7 TRCN0000056657 GCACTGGTGTGAAGATCACTT pLKO.1 1071 3UTR 100% 4.950 3.465 N ALOXE3 n/a
8 TRCN0000435986 AGTACCTGAATGGTGTCAATC pLKO_005 1103 3UTR 100% 10.800 6.480 N ALOXE3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001752579.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03879 pDONR223 100% 64.1% None 1_273del;1833_1834ins122;2285_3014del n/a
2 ccsbBroad304_03879 pLX_304 0% 64.1% V5 1_273del;1833_1834ins122;2285_3014del n/a
Download CSV