Transcript: Human XR_001752601.2

PREDICTED: Homo sapiens DNA topoisomerase III alpha (TOP3A), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TOP3A (7156)
Length:
8125
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001752601.2
NBCI Gene record:
TOP3A (7156)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001752601.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049296 CGGTGGCTAAAGCAAAGAAAT pLKO.1 2134 3UTR 100% 13.200 10.560 N TOP3A n/a
2 TRCN0000296836 TCCTGAGAAGGACGGTGTAAT pLKO_005 3720 3UTR 100% 13.200 10.560 N TOP3A n/a
3 TRCN0000296838 TGATTCCATGGGCTATGAAAT pLKO_005 1991 3UTR 100% 13.200 10.560 N TOP3A n/a
4 TRCN0000370354 CCACGTGTGTAAGGCTGTAAA pLKO_005 701 3UTR 100% 13.200 9.240 N TOP3A n/a
5 TRCN0000296879 GACTTCAGTTTCTGGACATTT pLKO_005 476 3UTR 100% 13.200 9.240 N TOP3A n/a
6 TRCN0000049294 CGAGTTTATTGTTCGCCATTT pLKO.1 1520 3UTR 100% 10.800 7.560 N TOP3A n/a
7 TRCN0000049295 GCCAGAATGTTACCATGGTAA pLKO.1 454 3UTR 100% 4.950 3.465 N TOP3A n/a
8 TRCN0000049297 GCTTCTCGAAAGTTGAGAATA pLKO.1 1224 3UTR 100% 1.320 0.924 N TOP3A n/a
9 TRCN0000291059 GCTTCTCGAAAGTTGAGAATA pLKO_005 1224 3UTR 100% 1.320 0.924 N TOP3A n/a
10 TRCN0000049293 CCAGAAATCTTCCACAGAATT pLKO.1 1008 3UTR 100% 0.000 0.000 N TOP3A n/a
11 TRCN0000116737 CCTCCCAAGTAGCTGGAATTA pLKO.1 6119 3UTR 100% 13.200 6.600 Y CLDN18 n/a
12 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 6257 3UTR 100% 10.800 5.400 Y MRPS16 n/a
13 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 3944 3UTR 100% 4.950 2.475 Y ORAI2 n/a
14 TRCN0000138391 CGCCTGTAATCCTAGCACTTT pLKO.1 5148 3UTR 100% 4.950 2.475 Y DENND6A n/a
15 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3867 3UTR 100% 13.200 6.600 Y LIAS n/a
16 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 6257 3UTR 100% 10.800 5.400 Y CD3EAP n/a
17 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 4032 3UTR 100% 10.800 5.400 Y SMIM11A n/a
18 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 3941 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001752601.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11616 pDONR223 100% 2.1% None (many diffs) n/a
2 ccsbBroad304_11616 pLX_304 0% 2.1% V5 (many diffs) n/a
3 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 2.1% V5 (many diffs) n/a
Download CSV