Transcript: Human XR_001753576.2

PREDICTED: Homo sapiens SURP and G-patch domain containing 2 (SUGP2), transcript variant X16, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SUGP2 (10147)
Length:
3861
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001753576.2
NBCI Gene record:
SUGP2 (10147)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001753576.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236400 GGCCTGAGAAGTGACGTATTT pLKO_005 291 3UTR 100% 13.200 18.480 N SUGP2 n/a
2 TRCN0000153826 CGTGAATCGTATTACTCCCAA pLKO.1 827 3UTR 100% 2.640 3.696 N SUGP2 n/a
3 TRCN0000153203 CCTCCTACGAAACCTGAAATT pLKO.1 1734 3UTR 100% 13.200 9.240 N SUGP2 n/a
4 TRCN0000236401 GAGAAGGAGAGTCGGGATTAT pLKO_005 609 3UTR 100% 13.200 9.240 N SUGP2 n/a
5 TRCN0000236403 GGTCATTGGCCACCGGAAATT pLKO_005 419 3UTR 100% 13.200 9.240 N SUGP2 n/a
6 TRCN0000153153 GAGTGTCACACCTTTGCTTAT pLKO.1 1370 3UTR 100% 10.800 7.560 N SUGP2 n/a
7 TRCN0000152597 GTCATTGAAGGTTGGCATGAT pLKO.1 2924 3UTR 100% 4.950 3.465 N SUGP2 n/a
8 TRCN0000156277 CTTTGGATCTTCCAGGCTGAT pLKO.1 572 3UTR 100% 4.050 2.835 N SUGP2 n/a
9 TRCN0000153979 CAAGTCATTGAAGGTTGGCAT pLKO.1 2921 3UTR 100% 2.640 1.848 N SUGP2 n/a
10 TRCN0000157731 CCTTCAGATCAAGCAACCCTT pLKO.1 322 3UTR 100% 2.640 1.848 N SUGP2 n/a
11 TRCN0000236402 TACCCACCGTGAATCGTATTA pLKO_005 820 3UTR 100% 0.000 0.000 N SUGP2 n/a
12 TRCN0000236404 TTACTGTCTCTGGCTTGTTTC pLKO_005 3664 3UTR 100% 10.800 6.480 N SUGP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001753576.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11459 pDONR223 100% 74.9% None (many diffs) n/a
2 ccsbBroad304_11459 pLX_304 0% 74.9% V5 (many diffs) n/a
3 TRCN0000477262 TGGCATAAAACTGAAAAGAGTGAG pLX_317 13.8% 74.9% V5 (many diffs) n/a
Download CSV