Transcript: Human XR_001753685.2

PREDICTED: Homo sapiens low density lipoprotein receptor (LDLR), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LDLR (3949)
Length:
5421
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001753685.2
NBCI Gene record:
LDLR (3949)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001753685.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000281534 GACATCCACCGTCAGGCTAAA pLKO_005 2503 3UTR 100% 10.800 15.120 N LDLR n/a
2 TRCN0000262146 GGGCGACAGATGCGAAAGAAA pLKO_005 186 3UTR 100% 5.625 7.875 N LDLR n/a
3 TRCN0000282121 GAGTCACTGGTCACCCTTAAT pLKO_005 3576 3UTR 100% 13.200 10.560 N LDLR n/a
4 TRCN0000262147 CTCCCGCCAAGATCAAGAAAG pLKO_005 1730 3UTR 100% 10.800 8.640 N LDLR n/a
5 TRCN0000056513 CCAGCGAAGATGCGAAGATAT pLKO.1 1161 3UTR 100% 13.200 9.240 N LDLR n/a
6 TRCN0000282124 GATGAAGTTGGCTGCGTTAAT pLKO_005 913 3UTR 100% 13.200 9.240 N LDLR n/a
7 TRCN0000262148 ACATCAACAGCATCAACTTTG pLKO_005 2784 3UTR 100% 10.800 7.560 N LDLR n/a
8 TRCN0000262145 ACGGTGGAGATAGTGACAATG pLKO_005 2615 3UTR 100% 10.800 7.560 N LDLR n/a
9 TRCN0000262149 ATGGAAGAACTGGCGGCTTAA pLKO_005 2761 3UTR 100% 10.800 7.560 N LDLR n/a
10 TRCN0000056516 CCACGTCTGCAATGACCTTAA pLKO.1 1095 3UTR 100% 10.800 7.560 N LDLR n/a
11 TRCN0000282125 GCTTGTCTGTCACCTGCAAAT pLKO_005 305 3UTR 100% 10.800 7.560 N LDLR n/a
12 TRCN0000056517 ACAGAGGATGAGGTCCACATT pLKO.1 2828 3UTR 100% 4.950 3.465 N LDLR n/a
13 TRCN0000056515 CGGGAAATGCATCTCCTACAA pLKO.1 225 3UTR 100% 4.950 3.465 N LDLR n/a
14 TRCN0000056514 GCCGTCTTTGAGGACAAAGTA pLKO.1 1951 3UTR 100% 0.563 0.394 N LDLR n/a
15 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 4056 3UTR 100% 4.950 2.475 Y ERAP2 n/a
16 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4057 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001753685.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492138 CTGCCGAGGCGACATTCCTTCCAT pLX_317 12.6% 47.5% V5 (many diffs) n/a
2 TRCN0000489663 AAACGTGTTAAACCTTAATTCCCA pLX_317 14.9% 47.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV