Transcript: Human XR_001753732.2

PREDICTED: Homo sapiens regulatory factor X2 (RFX2), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RFX2 (5990)
Length:
1967
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001753732.2
NBCI Gene record:
RFX2 (5990)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001753732.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014846 CGAAGGAATCACATCACACAA pLKO.1 766 3UTR 100% 4.950 3.465 N RFX2 n/a
2 TRCN0000014844 GCTCTCCTTCTGGAACTCTAA pLKO.1 1280 3UTR 100% 4.950 3.465 N RFX2 n/a
3 TRCN0000014847 CCAGTTCCACTACATCGAGAA pLKO.1 1253 3UTR 100% 4.050 2.835 N RFX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001753732.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06859 pDONR223 100% 73.6% None (many diffs) n/a
2 ccsbBroad304_06859 pLX_304 30.2% 73.6% V5 (many diffs) n/a
3 TRCN0000491438 GGGTTAACCCAGCTTGCTCCGTTC pLX_317 11.3% 73.6% V5 (many diffs) n/a
Download CSV