Transcript: Human XR_001754324.1

PREDICTED: Homo sapiens taspase 1 (TASP1), transcript variant X11, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TASP1 (55617)
Length:
3154
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001754324.1
NBCI Gene record:
TASP1 (55617)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001754324.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032342 CGCACCATACTGGCTAGAGAA pLKO.1 1815 3UTR 100% 4.950 6.930 N Tasp1 n/a
2 TRCN0000005965 GCACCATACTGGCTAGAGAAT pLKO.1 1816 3UTR 100% 4.950 6.930 N TASP1 n/a
3 TRCN0000425987 AGGAATGGGATCTAATCTAAA pLKO_005 1236 3UTR 100% 13.200 10.560 N TASP1 n/a
4 TRCN0000005964 CGAGCTTGTCAGAAGGCAATT pLKO.1 865 3UTR 100% 10.800 8.640 N TASP1 n/a
5 TRCN0000005963 CCTCATTGTGTGACCAGGAAT pLKO.1 2461 3UTR 100% 4.950 3.960 N TASP1 n/a
6 TRCN0000421536 GAAACAAAGCAGTCCTATAAA pLKO_005 757 3UTR 100% 15.000 10.500 N TASP1 n/a
7 TRCN0000420877 CAACTGTCGCTGATGTGATAT pLKO_005 2573 3UTR 100% 13.200 9.240 N TASP1 n/a
8 TRCN0000005966 CGGTTGCCAACAGACTCTTAT pLKO.1 1355 3UTR 100% 13.200 9.240 N TASP1 n/a
9 TRCN0000432143 GAAGCGTCTCAGAGGCATTTC pLKO_005 2201 3UTR 100% 10.800 7.560 N TASP1 n/a
10 TRCN0000415046 TCTCAGGTTTCGGCTGGTAAA pLKO_005 718 3UTR 100% 10.800 7.560 N TASP1 n/a
11 TRCN0000425319 TGCATGCAGGTGCAGGTTATC pLKO_005 803 3UTR 100% 10.800 7.560 N TASP1 n/a
12 TRCN0000005967 CAAGTTTATCAGTTCACCTTT pLKO.1 1895 3UTR 100% 4.950 3.465 N TASP1 n/a
13 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 437 3UTR 100% 4.050 2.025 Y Myt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001754324.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489233 CCTGGCGAGCATCCCAATCAAGTT pLX_317 28.7% 39.3% V5 (many diffs) n/a
2 TRCN0000487713 TCCGCTATTGTCCTTTTATGTTTA pLX_317 18.6% 39.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV