Transcript: Human XR_001754334.2

PREDICTED: Homo sapiens kizuna centrosomal protein (KIZ), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIZ (55857)
Length:
2754
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001754334.2
NBCI Gene record:
KIZ (55857)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001754334.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252522 ATCAACCAGCAACAATCTTTA pLKO_005 524 3UTR 100% 13.200 18.480 N Kiz n/a
2 TRCN0000423850 CCCGTTACGGGAAAGATTAAG pLKO_005 894 3UTR 100% 13.200 18.480 N KIZ n/a
3 TRCN0000137214 GCTGCAGATATCCCAATCACA pLKO.1 1723 3UTR 100% 3.000 4.200 N KIZ n/a
4 TRCN0000134581 GTCTGATACATGCAGAGTTAA pLKO.1 204 3UTR 100% 13.200 10.560 N KIZ n/a
5 TRCN0000420121 AGTCTCTCCGATACCAGTTTC pLKO_005 1023 3UTR 100% 10.800 7.560 N KIZ n/a
6 TRCN0000133823 CAAGGGAACAAGAAGTTTCAA pLKO.1 1667 3UTR 100% 5.625 3.938 N KIZ n/a
7 TRCN0000168010 CGAGACAAAGACAGCTAACAA pLKO.1 1875 3UTR 100% 5.625 3.938 N KIZ n/a
8 TRCN0000134625 GATTGTATCAACCAGCAACAA pLKO.1 518 3UTR 100% 4.950 3.465 N KIZ n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001754334.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08600 pDONR223 100% 72.3% None (many diffs) n/a
2 ccsbBroad304_08600 pLX_304 0% 72.3% V5 (many diffs) n/a
3 TRCN0000480441 ATCCGCTTCCAATAACCACGCATC pLX_317 14.3% 72.3% V5 (many diffs) n/a
Download CSV