Transcript: Human XR_001754443.2

PREDICTED: Homo sapiens TELO2 interacting protein 1 (TTI1), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TTI1 (9675)
Length:
3623
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001754443.2
NBCI Gene record:
TTI1 (9675)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001754443.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160234 CATTGTCGTATCTTCCCTAAA pLKO.1 789 3UTR 100% 10.800 15.120 N TTI1 n/a
2 TRCN0000162792 CCCTTAGCCTACCATCTCTAT pLKO.1 3429 3UTR 100% 4.950 6.930 N TTI1 n/a
3 TRCN0000161390 GCAGTCAATCATTGGTCGAAT pLKO.1 1061 3UTR 100% 4.950 6.930 N TTI1 n/a
4 TRCN0000161983 GCGACAAGTTGACTATCCTTA pLKO.1 950 3UTR 100% 4.950 6.930 N TTI1 n/a
5 TRCN0000162037 CGATCACACAACTGCTTAGAA pLKO.1 3320 3UTR 100% 5.625 3.938 N TTI1 n/a
6 TRCN0000099277 GCTGCCATGATCCTTAATGAA pLKO.1 1663 3UTR 100% 5.625 3.938 N Tti1 n/a
7 TRCN0000332266 GCTGCCATGATCCTTAATGAA pLKO_005 1663 3UTR 100% 5.625 3.938 N Tti1 n/a
8 TRCN0000163706 GCAGATGGAAATGTCTCGGAT pLKO.1 2566 3UTR 100% 2.640 1.848 N TTI1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001754443.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02225 pDONR223 100% 79.9% None (many diffs) n/a
2 ccsbBroad304_02225 pLX_304 0% 79.9% V5 (many diffs) n/a
3 TRCN0000491682 CCAGGATCCGCGAGGCATGTCCCT pLX_317 8.6% 79.9% V5 (many diffs) n/a
Download CSV