Transcript: Human XR_001755653.1

PREDICTED: Homo sapiens highly divergent homeobox (HDX), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HDX (139324)
Length:
3572
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001755653.1
NBCI Gene record:
HDX (139324)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001755653.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019280 CCAATCCATTACGGAGTAATT pLKO.1 1287 3UTR 100% 13.200 18.480 N HDX n/a
2 TRCN0000019281 CGAATGATGCAAGGGCTCATA pLKO.1 1746 3UTR 100% 4.950 6.930 N HDX n/a
3 TRCN0000019279 GCCCAGCATTACATAACTTAT pLKO.1 828 3UTR 100% 13.200 10.560 N HDX n/a
4 TRCN0000226161 TGGGATTCAAAGGTCATATAA pLKO_005 793 3UTR 100% 15.000 10.500 N Hdx n/a
5 TRCN0000226160 TGTCATTGTAACTGGTATATA pLKO_005 430 3UTR 100% 15.000 10.500 N Hdx n/a
6 TRCN0000416717 GAAGAAGGAAATATCGTTTAA pLKO_005 1533 3UTR 100% 13.200 9.240 N HDX n/a
7 TRCN0000435935 TCATTGGCAGTTAGCGATTAC pLKO_005 917 3UTR 100% 10.800 7.560 N HDX n/a
8 TRCN0000019282 GCCAATAATGATGTCATTGTA pLKO.1 419 3UTR 100% 5.625 3.938 N HDX n/a
9 TRCN0000019283 GCTCAGCAGAAGGAAATTGTT pLKO.1 978 3UTR 100% 5.625 3.375 N HDX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001755653.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04927 pDONR223 100% 55.5% None 1_118del;1369_1370ins54;2135_3572del n/a
2 TRCN0000477382 TCCCTCGAGGGGGTGTACCTGGAA pLX_317 20.3% 55.5% V5 1_118del;1369_1370ins54;2135_3572del n/a
Download CSV