Transcript: Human XR_001755734.1

PREDICTED: Homo sapiens pseudouridine 5'-phosphatase (PUDP), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PUDP (8226)
Length:
1667
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001755734.1
NBCI Gene record:
PUDP (8226)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001755734.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365199 GTAATCGCTATGACAAGAAAT pLKO_005 140 3UTR 100% 13.200 18.480 N PUDP n/a
2 TRCN0000365256 TGGATACTGAACGGCTGTATT pLKO_005 98 3UTR 100% 13.200 18.480 N PUDP n/a
3 TRCN0000051203 CGTCGTTCGATATGAAGACAA pLKO.1 392 3UTR 100% 4.950 6.930 N PUDP n/a
4 TRCN0000370325 TTGCAGCTCCCGATGTCCAAA pLKO_005 232 3UTR 100% 4.950 3.960 N PUDP n/a
5 TRCN0000051204 CAGTGGTGTTTCAAGAAATAT pLKO.1 119 3UTR 100% 15.000 10.500 N PUDP n/a
6 TRCN0000370380 AGGCGGCACAGATTATAATAG pLKO_005 206 3UTR 100% 13.200 9.240 N PUDP n/a
7 TRCN0000370324 TCATCATCCACCTGCGGAAAC pLKO_005 332 3UTR 100% 6.000 4.200 N PUDP n/a
8 TRCN0000051206 GTTATGGGTAAGAAGGCATTA pLKO.1 184 3UTR 100% 10.800 6.480 N PUDP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001755734.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11262 pDONR223 100% 36.1% None (many diffs) n/a
2 ccsbBroad304_11262 pLX_304 0% 36.1% V5 (many diffs) n/a
3 TRCN0000472581 CCAGACCTTACAAATCCACTCGAC pLX_317 59% 36.1% V5 (many diffs) n/a
Download CSV