Transcript: Mouse XR_001779914.1

PREDICTED: Mus musculus nemo like kinase (Nlk), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nlk (18099)
Length:
4686
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001779914.1
NBCI Gene record:
Nlk (18099)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001779914.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023256 CCGACAGGTTAAAGAAATTAT pLKO.1 2771 3UTR 100% 15.000 21.000 N Nlk n/a
2 TRCN0000226072 ATTGGATGAATCCCGTCATAT pLKO_005 2199 3UTR 100% 13.200 18.480 N Nlk n/a
3 TRCN0000023255 GCTCGGATCATGTCAAAGTTT pLKO.1 2039 3UTR 100% 5.625 7.875 N Nlk n/a
4 TRCN0000023258 GCCGGATAGACCAATTGGATA pLKO.1 1746 3UTR 100% 4.950 6.930 N Nlk n/a
5 TRCN0000023257 GCTGAGATACCATACGTGTAT pLKO.1 2642 3UTR 100% 4.950 6.930 N Nlk n/a
6 TRCN0000023254 CCGTCATTACAGCAATGCTAT pLKO.1 2274 3UTR 100% 4.950 3.960 N Nlk n/a
7 TRCN0000002068 CGGGAATTGAAGATGTTGTGT pLKO.1 1879 3UTR 100% 3.000 2.400 N NLK n/a
8 TRCN0000226071 ACCTCCACACATTGACTATTT pLKO_005 1944 3UTR 100% 13.200 9.240 N Nlk n/a
9 TRCN0000226073 GAGCTACTGGGCCGAAGAATA pLKO_005 2326 3UTR 100% 13.200 9.240 N Nlk n/a
10 TRCN0000218649 GATGCAGAGTGATCTACATAA pLKO_005 1992 3UTR 100% 13.200 9.240 N Nlk n/a
11 TRCN0000226074 TGAGATGTCACAGTAGTAAAT pLKO_005 3931 3UTR 100% 13.200 9.240 N Nlk n/a
12 TRCN0000002067 CTTTGCAGGATGTTGGTCTTT pLKO.1 2539 3UTR 100% 4.950 3.465 N NLK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001779914.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12008 pDONR223 100% 31% None (many diffs) n/a
2 ccsbBroad304_12008 pLX_304 0% 31% V5 (many diffs) n/a
3 TRCN0000478604 TAGTTCATAAAGTCCTGTACGTTG pLX_317 24.7% 31% V5 (many diffs) n/a
4 ccsbBroadEn_15073 pDONR223 0% 31% None (many diffs) n/a
5 ccsbBroad304_15073 pLX_304 0% 31% V5 (many diffs) n/a
6 TRCN0000466716 CTTAACTCTCCCTAGTTGAACAGG pLX_317 20% 31% V5 (many diffs) n/a
Download CSV