Transcript: Mouse XR_001779934.1

PREDICTED: Mus musculus solute carrier family 22 (organic cation transporter), member 5 (Slc22a5), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc22a5 (20520)
Length:
3216
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001779934.1
NBCI Gene record:
Slc22a5 (20520)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001779934.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070221 GATCGCTTCCTGCCTTATATT pLKO.1 1734 3UTR 100% 15.000 21.000 N Slc22a5 n/a
2 TRCN0000288547 GATCGCTTCCTGCCTTATATT pLKO_005 1734 3UTR 100% 15.000 21.000 N Slc22a5 n/a
3 TRCN0000070219 GCTAAGGGTCAAAGGAATAAA pLKO.1 1847 3UTR 100% 15.000 10.500 N Slc22a5 n/a
4 TRCN0000288472 GCTAAGGGTCAAAGGAATAAA pLKO_005 1847 3UTR 100% 15.000 10.500 N Slc22a5 n/a
5 TRCN0000070220 CCAAGTGAGTTACAAGACTTA pLKO.1 1218 3UTR 100% 4.950 3.465 N Slc22a5 n/a
6 TRCN0000288545 CCAAGTGAGTTACAAGACTTA pLKO_005 1218 3UTR 100% 4.950 3.465 N Slc22a5 n/a
7 TRCN0000070222 TGGTCGCAAGAATGTGCTGTT pLKO.1 763 3UTR 100% 4.050 2.835 N Slc22a5 n/a
8 TRCN0000070218 GCTGTTTATGTCTCAAGCTAT pLKO.1 2770 3UTR 100% 4.950 2.970 N Slc22a5 n/a
9 TRCN0000295789 GCTAGACATGCTTTGTTATTT pLKO_005 2216 3UTR 100% 15.000 7.500 Y Slc22a5 n/a
10 TRCN0000295729 GACCATATCAGTGGGCTATTT pLKO_005 1331 3UTR 100% 13.200 6.600 Y Slc22a5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001779934.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06974 pDONR223 100% 45.1% None (many diffs) n/a
2 ccsbBroad304_06974 pLX_304 0% 45.1% V5 (many diffs) n/a
3 TRCN0000476123 ATTCCGCTAATGAGCCTCCCGTCA pLX_317 21.9% 45.1% V5 (many diffs) n/a
Download CSV