Transcript: Mouse XR_001780011.1

PREDICTED: Mus musculus mannoside acetylglucosaminyltransferase 5, isoenzyme B (Mgat5b), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mgat5b (268510)
Length:
4363
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001780011.1
NBCI Gene record:
Mgat5b (268510)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001780011.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428028 CGTGTGGACCGTGGACTATAA pLKO_005 2508 3UTR 100% 13.200 18.480 N Mgat5b n/a
2 TRCN0000438393 ATGGTGAAGCGCATGGATATG pLKO_005 861 3UTR 100% 10.800 8.640 N Mgat5b n/a
3 TRCN0000110336 GCTCTTTATAGGGTTCGGATT pLKO.1 2313 3UTR 100% 4.050 3.240 N Mgat5b n/a
4 TRCN0000110337 CCATTTGTCTTAGCTCCTAAT pLKO.1 2707 3UTR 100% 10.800 7.560 N Mgat5b n/a
5 TRCN0000428466 CGTACAACCACGAGGAGTATG pLKO_005 1819 3UTR 100% 10.800 7.560 N Mgat5b n/a
6 TRCN0000110338 GACCTCATCTACACGGACTAT pLKO.1 1704 3UTR 100% 4.950 3.465 N Mgat5b n/a
7 TRCN0000110339 CATCACTTGTACCCTGCCTTT pLKO.1 2947 3UTR 100% 4.050 2.835 N Mgat5b n/a
8 TRCN0000110335 CCTATTCACCAGAGGTCTCAA pLKO.1 3476 3UTR 100% 4.950 2.970 N Mgat5b n/a
9 TRCN0000294082 AGCAGTTCATGACCATGTTTC pLKO_005 1891 3UTR 100% 10.800 6.480 N MGAT5B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001780011.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.