Transcript: Mouse XR_001780040.1

PREDICTED: Mus musculus WD repeat domain 45B (Wdr45b), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wdr45b (66840)
Length:
2274
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001780040.1
NBCI Gene record:
Wdr45b (66840)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001780040.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173506 GCGGAGAGATAGAATTGTGGT pLKO.1 468 3UTR 100% 2.640 3.696 N Wdr45b n/a
2 TRCN0000298084 GCGGAGAGATAGAATTGTGGT pLKO_005 468 3UTR 100% 2.640 3.696 N Wdr45b n/a
3 TRCN0000175343 CGTCTTTGAAACCTGCTACAA pLKO.1 546 3UTR 100% 4.950 3.960 N Wdr45b n/a
4 TRCN0000298082 CGTCTTTGAAACCTGCTACAA pLKO_005 546 3UTR 100% 4.950 3.960 N Wdr45b n/a
5 TRCN0000216803 GATTAAGGTGTTCACGTTCAC pLKO.1 504 3UTR 100% 4.050 3.240 N Wdr45b n/a
6 TRCN0000215419 GAAATGTTATTTCGCTGTAAC pLKO.1 319 3UTR 100% 10.800 7.560 N Wdr45b n/a
7 TRCN0000173574 GAGGATCTCAAGCAGCCAATA pLKO.1 790 3UTR 100% 10.800 7.560 N Wdr45b n/a
8 TRCN0000292933 GAGGATCTCAAGCAGCCAATA pLKO_005 790 3UTR 100% 10.800 7.560 N Wdr45b n/a
9 TRCN0000194470 GCAAGGCTTCTCATCCCATAT pLKO.1 1299 3UTR 100% 10.800 7.560 N Wdr45b n/a
10 TRCN0000174296 CCATAGGAACACACTAACATT pLKO.1 1931 3UTR 100% 5.625 3.938 N Wdr45b n/a
11 TRCN0000292934 CCATAGGAACACACTAACATT pLKO_005 1931 3UTR 100% 5.625 3.938 N Wdr45b n/a
12 TRCN0000217694 GAAGACAGTCATCGAGATAGA pLKO.1 417 3UTR 100% 4.950 3.465 N Wdr45b n/a
13 TRCN0000146668 CCATGATTAAGGTGTTCACAT pLKO.1 500 3UTR 100% 4.950 6.930 N WDR45B n/a
14 TRCN0000128386 GAGATAGAATTGTGGTGGTTT pLKO.1 473 3UTR 100% 4.950 3.465 N WDR45B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001780040.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14218 pDONR223 100% 32% None (many diffs) n/a
Download CSV