Transcript: Mouse XR_001780461.1

PREDICTED: Mus musculus tubulin tyrosine ligase-like family, member 5 (Ttll5), transcript variant X26, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ttll5 (320244)
Length:
2532
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001780461.1
NBCI Gene record:
Ttll5 (320244)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001780461.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253179 AGTTGCCGAGTGGACTAATAA pLKO_005 2112 3UTR 100% 15.000 21.000 N Ttll5 n/a
2 TRCN0000253181 CCGAGGACCTTGGATAGTAAA pLKO_005 784 3UTR 100% 13.200 18.480 N Ttll5 n/a
3 TRCN0000253177 CGGACATCCAACCGGTCAATT pLKO_005 1478 3UTR 100% 13.200 18.480 N Ttll5 n/a
4 TRCN0000253180 CCGAGCAGCACTGACTATAAT pLKO_005 536 3UTR 100% 15.000 10.500 N Ttll5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001780461.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11673 pDONR223 100% 28.1% None (many diffs) n/a
2 ccsbBroad304_11673 pLX_304 0% 28.1% V5 (many diffs) n/a
3 TRCN0000478925 ATCCGGCTGTATACCAGCTGTGGC pLX_317 57.9% 28.1% V5 (many diffs) n/a
Download CSV