Construct: ORF TRCN0000478925
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000354.1_s317c1
- Derived from:
- ccsbBroadEn_11673
- DNA Barcode:
- ATCCGGCTGTATACCAGCTGTGGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TTLL5 (23093)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478925
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23093 | TTLL5 | tubulin tyrosine ligase like 5 | NM_015072.5 | 20.2% | 19.2% | (many diffs) |
| 2 | mouse | 320244 | Ttll5 | tubulin tyrosine ligase-lik... | XM_017315115.1 | 42% | 42.6% | (many diffs) |
| 3 | mouse | 320244 | Ttll5 | tubulin tyrosine ligase-lik... | XM_017315114.1 | 41.9% | 42.5% | (many diffs) |
| 4 | mouse | 320244 | Ttll5 | tubulin tyrosine ligase-lik... | XM_006516008.3 | 33.8% | 34.2% | (many diffs) |
| 5 | mouse | 320244 | Ttll5 | tubulin tyrosine ligase-lik... | XR_001780461.1 | 28.1% | (many diffs) | |
| 6 | mouse | 320244 | Ttll5 | tubulin tyrosine ligase-lik... | XR_001780460.1 | 24.8% | (many diffs) | |
| 7 | mouse | 320244 | Ttll5 | tubulin tyrosine ligase-lik... | XM_017315110.1 | 18.8% | 19% | (many diffs) |
| 8 | mouse | 320244 | Ttll5 | tubulin tyrosine ligase-lik... | XM_006515998.3 | 18.8% | 19% | (many diffs) |
| 9 | mouse | 320244 | Ttll5 | tubulin tyrosine ligase-lik... | XM_017315109.1 | 18.3% | 18.6% | (many diffs) |
| 10 | mouse | 320244 | Ttll5 | tubulin tyrosine ligase-lik... | NM_001347395.1 | 18.3% | 18.6% | (many diffs) |
| 11 | mouse | 320244 | Ttll5 | tubulin tyrosine ligase-lik... | XM_006515996.3 | 18.2% | 18.5% | (many diffs) |
| 12 | mouse | 320244 | Ttll5 | tubulin tyrosine ligase-lik... | XM_017315108.1 | 18.2% | 18.4% | (many diffs) |
| 13 | mouse | 320244 | Ttll5 | tubulin tyrosine ligase-lik... | XM_006515995.3 | 18% | 18.3% | (many diffs) |
| 14 | mouse | 320244 | Ttll5 | tubulin tyrosine ligase-lik... | XM_006515994.3 | 17.9% | 18.2% | (many diffs) |
| 15 | mouse | 320244 | Ttll5 | tubulin tyrosine ligase-lik... | XM_006515993.3 | 17.9% | 18.1% | (many diffs) |
| 16 | mouse | 320244 | Ttll5 | tubulin tyrosine ligase-lik... | NM_001081423.2 | 17.9% | 18.1% | (many diffs) |
| 17 | mouse | 320244 | Ttll5 | tubulin tyrosine ligase-lik... | XM_006515992.3 | 17.8% | 18% | (many diffs) |
| 18 | mouse | 320244 | Ttll5 | tubulin tyrosine ligase-lik... | XM_006515989.3 | 17.7% | 18% | (many diffs) |
| 19 | mouse | 320244 | Ttll5 | tubulin tyrosine ligase-lik... | XM_006515990.3 | 17.7% | 18% | (many diffs) |
| 20 | mouse | 320244 | Ttll5 | tubulin tyrosine ligase-lik... | XM_006515991.2 | 17.7% | 18% | (many diffs) |
| 21 | mouse | 320244 | Ttll5 | tubulin tyrosine ligase-lik... | XM_017315111.1 | 11.8% | 11.8% | (many diffs) |
| 22 | mouse | 320244 | Ttll5 | tubulin tyrosine ligase-lik... | XM_006515999.3 | 11.2% | 11.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 873
- ORF length:
- 807
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc aatcgtgatg gcccgggacc tggaggaaac agcatcatcc tcagaggatg 121 aggaggtcat aagtcaagag gatcatccat gcatcatgtg gactggaggc tgcaggagaa 181 ttccagtttt ggtattccat gccgacgcta ttcttacaaa ggacaacaat attagagtaa 241 ttggagaacg ttatcatttg tcttataaga ttgtacgaac ggacagtcgc ctagtacgca 301 gcattctgac agcccatgga tttcatgaag ttcacccaag cagcactgac tataacctaa 361 tgtggacagg atcccacctg aagcccttct tactgcgcac cctcTCTGAA GCACAAAAAG 421 TTAATCACTT TCCCAGGTCT TATGAACTTA CCCGGAAGGA CCGACTGTAC AAAAACATTA 481 TTCGAATGCA GCATACACAT GGATTCAAGG CTTTTCACAT CCTCCCCCAG ACCTTCCTCC 541 TGCCAGCTGA GTACGCGGAA TTTTGTAATT CATATTCGAA GGACCGGGGA CCTTGGATAG 601 TAAAACCAGT GGCATCTTCA AGGGGGCGGG GCGTCTACCT GATCAACAAT CCAAACCAGA 661 TCTCCCTGGA AGACAACATT TTGGTCTCCC GTTACATTAA CAACCCCCTG CTCATAGATG 721 ATTTCAAGTT TGACATGCGC CTCTATGTGC TCGTGACTTC CTATGATCCT CTTGTCATCT 781 ATCTCTATGA AGAAGGATTG GCTAGAAAAT GCAATTGGAA GATGGGAAAT ACCATGGATA 841 AAAGAAGGCT ACCTATTTAT GTACAGGTGC TTTGCCCAAC TTTCTTGTAC AAAGTGGTTG 901 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 961 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGAAT 1021 CCGGCTGTAT ACCAGCTGTG GCACGCGTTA AGTCgacaat caacctctgg attacaaaat 1081 ttgtgaaaga tt