Transcript: Mouse XR_001780474.1

PREDICTED: Mus musculus SMEK homolog 1, suppressor of mek1 (Dictyostelium) (Smek1), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppp4r3a (68734)
Length:
3092
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001780474.1
NBCI Gene record:
Ppp4r3a (68734)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001780474.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250196 CGAAGTGCTGCTACGGATATA pLKO_005 1356 3UTR 100% 13.200 18.480 N Ppp4r3a n/a
2 TRCN0000183479 GCCCATGTAATTGAGAATTAT pLKO.1 2193 3UTR 100% 15.000 12.000 N Ppp4r3a n/a
3 TRCN0000160447 CAGATTTGTTTGCACAACTAA pLKO.1 1159 3UTR 100% 5.625 4.500 N PPP4R3A n/a
4 TRCN0000250197 CTGATGAACTCCGCCATAATA pLKO_005 2127 3UTR 100% 15.000 10.500 N Ppp4r3a n/a
5 TRCN0000250193 ACGAAGAATGACGATGATATT pLKO_005 2448 3UTR 100% 13.200 9.240 N Ppp4r3a n/a
6 TRCN0000250195 ATGGGCCTGCTTCGAACTTTA pLKO_005 1530 3UTR 100% 13.200 9.240 N Ppp4r3a n/a
7 TRCN0000159890 GCACAACAGAATGATGATGAT pLKO.1 1434 3UTR 100% 4.950 3.465 N PPP4R3A n/a
8 TRCN0000178838 CTGACAGATTTGTTTGCACAA pLKO.1 1155 3UTR 100% 4.050 2.835 N Ppp4r3a n/a
9 TRCN0000159820 GCATGCTTTCTTGGCATTATA pLKO.1 1826 3UTR 100% 15.000 9.000 N PPP4R3A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001780474.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12246 pDONR223 100% 52% None (many diffs) n/a
2 TRCN0000481139 GGTCTAAAGTTATAACAAACTGGT pLX_317 20.8% 52% V5 (many diffs) n/a
3 ccsbBroadEn_14203 pDONR223 94.5% 5.3% None (many diffs) n/a
4 ccsbBroad304_14203 pLX_304 0% 5.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV