Transcript: Mouse XR_001780775.1

PREDICTED: Mus musculus family with sequence similarity 120, member A (Fam120a), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam120a (218236)
Length:
4793
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001780775.1
NBCI Gene record:
Fam120a (218236)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001780775.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074922 GCCTTGAATAATGACTCTAAA pLKO.1 3094 3UTR 100% 13.200 18.480 N FAM120A n/a
2 TRCN0000346019 TGCTGCGTCTTACGGTATATG pLKO_005 2014 3UTR 100% 13.200 18.480 N Fam120a n/a
3 TRCN0000346094 TAAGAGAGCAGTTGGATATTA pLKO_005 1012 3UTR 100% 15.000 10.500 N Fam120a n/a
4 TRCN0000346000 TCAAAGCCGTAGCTGATTATG pLKO_005 897 3UTR 100% 13.200 9.240 N Fam120a n/a
5 TRCN0000283467 CCGTTTGGAATATCAACATTA pLKO_005 4247 3UTR 100% 13.200 7.920 N Fam120a n/a
6 TRCN0000074919 CGTGCAATACAAATCCTCATT pLKO.1 3116 3UTR 100% 4.950 6.930 N FAM120A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001780775.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07851 pDONR223 100% 58% None (many diffs) n/a
2 ccsbBroad304_07851 pLX_304 0% 58% V5 (many diffs) n/a
3 TRCN0000476487 TTGCCACTAGACTTATAACTTATA pLX_317 9.1% 58% V5 (many diffs) n/a
4 ccsbBroadEn_02734 pDONR223 100% 58% None (many diffs) n/a
5 ccsbBroad304_02734 pLX_304 0% 58% V5 (many diffs) n/a
6 TRCN0000480694 ATACAGGGTGCACGCCTTGCGCGT pLX_317 13.6% 58% V5 (many diffs) n/a
Download CSV