Transcript: Mouse XR_001780787.1

PREDICTED: Mus musculus transient receptor potential cation channel, subfamily C, member 7 (Trpc7), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Trpc7 (26946)
Length:
3663
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001780787.1
NBCI Gene record:
Trpc7 (26946)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001780787.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068458 GCCGAATCAAACTCGCCATTA pLKO.1 1412 3UTR 100% 10.800 15.120 N Trpc7 n/a
2 TRCN0000068459 GCCAACATTGAGACTGAATTT pLKO.1 1243 3UTR 100% 13.200 9.240 N Trpc7 n/a
3 TRCN0000068460 GCAAAGTACAACCCAGCGTTT pLKO.1 2264 3UTR 100% 4.050 2.835 N Trpc7 n/a
4 TRCN0000068462 CTTACTTTGATGAAGGAAGAA pLKO.1 2535 3UTR 100% 4.950 2.970 N Trpc7 n/a
5 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3420 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001780787.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08701 pDONR223 100% 60.5% None (many diffs) n/a
2 ccsbBroad304_08701 pLX_304 0% 60.5% V5 (many diffs) n/a
3 TRCN0000474370 AGTTTATTACCGTTTACCAAGGCC pLX_317 18.3% 60.5% V5 (many diffs) n/a
Download CSV