Transcript: Mouse XR_001780827.1

PREDICTED: Mus musculus inositol 1,3,4,5,6-pentakisphosphate 2-kinase (Ippk), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ippk (75678)
Length:
2828
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001780827.1
NBCI Gene record:
Ippk (75678)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001780827.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321665 GAGCGGTTAGGGCTTAGTATG pLKO_005 2102 3UTR 100% 10.800 15.120 N Ippk n/a
2 TRCN0000155205 GCCGATTCTGTGTGTAGAGAT pLKO.1 585 3UTR 100% 4.950 6.930 N IPPK n/a
3 TRCN0000221754 GCCGATTCTGTGTGTAGAGAT pLKO.1 585 3UTR 100% 4.950 6.930 N Ippk n/a
4 TRCN0000297476 GCCGATTCTGTGTGTAGAGAT pLKO_005 585 3UTR 100% 4.950 6.930 N IPPK n/a
5 TRCN0000321750 GCCGATTCTGTGTGTAGAGAT pLKO_005 585 3UTR 100% 4.950 6.930 N Ippk n/a
6 TRCN0000221752 CGACCTCTACTCAGGAAATAA pLKO.1 744 3UTR 100% 15.000 10.500 N Ippk n/a
7 TRCN0000321663 CGACCTCTACTCAGGAAATAA pLKO_005 744 3UTR 100% 15.000 10.500 N Ippk n/a
8 TRCN0000194914 CGATTCTGTGTGTAGAGATTA pLKO.1 587 3UTR 100% 13.200 9.240 N LOC441655 n/a
9 TRCN0000221755 GCTGCCTTTAGAGTTTGTGAA pLKO.1 432 3UTR 100% 4.950 3.465 N Ippk n/a
10 TRCN0000221753 GCAGCAATACAGAGTAGCCAT pLKO.1 1300 3UTR 100% 2.640 1.848 N Ippk n/a
11 TRCN0000221756 CCCTATGAGAGCATTCCTCAT pLKO.1 1457 3UTR 100% 0.405 0.243 N Ippk n/a
12 TRCN0000321664 CCCTATGAGAGCATTCCTCAT pLKO_005 1457 3UTR 100% 0.405 0.243 N Ippk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001780827.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03963 pDONR223 100% 42.5% None (many diffs) n/a
2 ccsbBroad304_03963 pLX_304 0% 42.5% V5 (many diffs) n/a
3 TRCN0000476710 GCACGTTTCGATCCGCGCTTTTAA pLX_317 18.3% 42.5% V5 (many diffs) n/a
4 TRCN0000491380 CCATGCGCGCTTCGTAACGGTACA pLX_317 21.9% 42.5% V5 (many diffs) n/a
5 TRCN0000487960 ATATATTTTAATACGTGCAGTCCA pLX_317 22.1% 42.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV