Transcript: Mouse XR_001781087.1

PREDICTED: Mus musculus propionyl-Coenzyme A carboxylase, alpha polypeptide (Pcca), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pcca (110821)
Length:
10374
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001781087.1
NBCI Gene record:
Pcca (110821)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001781087.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000306131 ATCGATAACCCTCGTCATATA pLKO_005 8832 3UTR 100% 13.200 18.480 N Pcca n/a
2 TRCN0000339287 TCGATAACCCTCGTCATATAG pLKO_005 8833 3UTR 100% 13.200 18.480 N Pcca n/a
3 TRCN0000112468 CCCTACAAGTCTTTCGGTTTA pLKO.1 9255 3UTR 100% 10.800 15.120 N Pcca n/a
4 TRCN0000306062 AGTGACATCAGCATCTATTAT pLKO_005 9357 3UTR 100% 15.000 10.500 N Pcca n/a
5 TRCN0000078427 GCAGTTGAATGTCGGGTTTAT pLKO.1 9225 3UTR 100% 13.200 9.240 N PCCA n/a
6 TRCN0000339286 GCAGTTGAATGTCGGGTTTAT pLKO_005 9225 3UTR 100% 13.200 9.240 N Pcca n/a
7 TRCN0000112467 GCCTGGACTTAGTCCAAGAAA pLKO.1 9139 3UTR 100% 5.625 3.938 N Pcca n/a
8 TRCN0000112466 CGAAACTAAATGTGACCAGTA pLKO.1 9820 3UTR 100% 4.050 2.835 N Pcca n/a
9 TRCN0000112469 GTCACTTTCATTGGACCTGAT pLKO.1 8523 3UTR 100% 4.050 2.835 N Pcca n/a
10 TRCN0000325846 GTCACTTTCATTGGACCTGAT pLKO_005 8523 3UTR 100% 4.050 2.835 N Pcca n/a
11 TRCN0000078423 CGTCATATAGAAATCCAGGTT pLKO.1 8844 3UTR 100% 2.640 1.848 N PCCA n/a
12 TRCN0000078426 GCAGGTGGAAACATGAGCATT pLKO.1 9918 3UTR 100% 4.950 3.465 N PCCA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001781087.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11018 pDONR223 100% 17.7% None (many diffs) n/a
2 ccsbBroad304_11018 pLX_304 0% 17.7% V5 (many diffs) n/a
3 TRCN0000477380 CACATGCGCCTAGGTGTCCATTCG pLX_317 21.2% 17.7% V5 (many diffs) n/a
Download CSV