Transcript: Mouse XR_001781605.1

PREDICTED: Mus musculus predicted gene, 17756 (Gm17756), misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm17756 (669751)
Length:
207
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001781605.1
NBCI Gene record:
Gm17756 (669751)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001781605.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070094 CGGATCCATATATGCATTAAT pLKO.1 166 3UTR 100% 15.000 12.000 N LOC432929 n/a
2 TRCN0000273511 AGCCAAGTCGGCAGTTTGTAA pLKO_005 26 3UTR 100% 5.625 3.375 N SEC61G n/a
3 TRCN0000381569 GATGCACCAAACCCGACAGAA pLKO_005 71 3UTR 100% 4.950 2.475 Y Sec61g n/a
4 TRCN0000273514 ATTCCAGAAGATTGCCATGGC pLKO_005 96 3UTR 100% 2.160 1.080 Y SEC61G n/a
5 TRCN0000100516 GCAGTTTGTAAAGGACTCAAT pLKO.1 36 3UTR 100% 4.950 2.475 Y Sec61g n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001781605.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02776 pDONR223 100% 87.5% None (many diffs) n/a
2 ccsbBroad304_02776 pLX_304 0% 87.5% V5 (many diffs) n/a
3 TRCN0000466863 AATTTTGGCGTTCCAACTTCGCGC pLX_317 100% 87.5% V5 (many diffs) n/a
Download CSV