Transcript: Mouse XR_001781614.1

PREDICTED: Mus musculus 60S ribosomal protein L23a pseudogene (LOC108168233), misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
LOC108168233 (108168233)
Length:
566
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001781614.1
NBCI Gene record:
LOC108168233 (108168233)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001781614.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104445 CCAAAGTCAATACCCTGATAA pLKO.1 389 3UTR 100% 13.200 6.600 Y Rpl23a n/a
2 TRCN0000104447 CCACTATGCTATCATCAAATT pLKO.1 240 3UTR 100% 13.200 6.600 Y Rpl23a n/a
3 TRCN0000263159 GAAACAAGCTTGACCACTATG pLKO_005 227 3UTR 100% 10.800 5.400 Y RPL23AP74 n/a
4 TRCN0000104446 GCCAATAAGCATCAGATCAAA pLKO.1 334 3UTR 100% 5.625 2.813 Y Rpl23a n/a
5 TRCN0000104448 TCAGATCAAACAGGCTGTCAA pLKO.1 345 3UTR 100% 4.950 2.475 Y Rpl23a n/a
6 TRCN0000104449 TGACCACTATGCTATCATCAA pLKO.1 237 3UTR 100% 4.950 2.475 Y Rpl23a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001781614.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06884 pDONR223 100% 73.3% None (many diffs) n/a
2 ccsbBroad304_06884 pLX_304 0% 73.3% V5 (many diffs) n/a
3 TRCN0000466199 GAATTTGCATACAAAGTAATAGGC pLX_317 60.8% 73.3% V5 (many diffs) n/a
Download CSV