Transcript: Mouse XR_001781853.1

PREDICTED: Mus musculus transmembrane protein 39a (Tmem39a), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem39a (67846)
Length:
3090
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001781853.1
NBCI Gene record:
Tmem39a (67846)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001781853.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173640 CGGTCAGCTTTACCTTCCATA pLKO.1 443 3UTR 100% 4.950 6.930 N Tmem39a n/a
2 TRCN0000175817 GAGTACCCAGTATTACGACAT pLKO.1 1318 3UTR 100% 4.050 5.670 N Tmem39a n/a
3 TRCN0000194407 CCTTACAATGTAGCAGTGCCT pLKO.1 2564 3UTR 100% 0.660 0.924 N Tmem39a n/a
4 TRCN0000194079 GCAGATGTTTATATCGAGCCA pLKO.1 2538 3UTR 100% 0.660 0.924 N Tmem39a n/a
5 TRCN0000446638 GCGGCACAGCAGATGTTTATA pLKO_005 2530 3UTR 100% 15.000 10.500 N Tmem39a n/a
6 TRCN0000423369 GGCTATCCGTTTGGTGTTTAT pLKO_005 968 3UTR 100% 13.200 9.240 N Tmem39a n/a
7 TRCN0000142829 CCTCATTATGGTGTGGATCAA pLKO.1 1357 3UTR 100% 4.950 3.465 N TMEM39A n/a
8 TRCN0000173362 GAGCATGGGTTCTACAGCAAT pLKO.1 1472 3UTR 100% 4.950 3.465 N Tmem39a n/a
9 TRCN0000194535 GCTTGAGGAACAGGAATGGTA pLKO.1 501 3UTR 100% 3.000 2.100 N Tmem39a n/a
10 TRCN0000175098 GCAATGAAGTAGAATGTCTGA pLKO.1 1206 3UTR 100% 2.640 1.848 N Tmem39a n/a
11 TRCN0000140693 GCACCTCATTATGGTGTGGAT pLKO.1 1354 3UTR 100% 2.640 1.848 N TMEM39A n/a
12 TRCN0000432755 GAGCCATGGGACCTTACAATG pLKO_005 2553 3UTR 100% 10.800 6.480 N Tmem39a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001781853.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08498 pDONR223 100% 42.4% None (many diffs) n/a
2 ccsbBroad304_08498 pLX_304 0% 42.4% V5 (many diffs) n/a
3 TRCN0000471521 GCTCTTTGGACTACAATACAGCCC pLX_317 26.8% 42.4% V5 (many diffs) n/a
4 TRCN0000481331 TTTCGGATGGACACTTGGAAGTAT pLX_317 84.2% 12.6% V5 (not translated due to frame shift) (many diffs) n/a
5 ccsbBroadEn_15892 pDONR223 0% 12.5% None (many diffs) n/a
6 ccsbBroad304_15892 pLX_304 0% 12.5% V5 (many diffs) n/a
Download CSV