Transcript: Mouse XR_001782058.1

PREDICTED: Mus musculus phosphodiesterase 9A (Pde9a), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pde9a (18585)
Length:
2001
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001782058.1
NBCI Gene record:
Pde9a (18585)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001782058.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114895 CGAGACAAAGTGACCAAAGCA pLKO.1 1320 3UTR 100% 3.000 2.400 N Pde9a n/a
2 TRCN0000114894 GCTGAGCTGTTTAGAACATAT pLKO.1 706 3UTR 100% 13.200 9.240 N Pde9a n/a
3 TRCN0000114891 GACCTGCTACAGACCATGTTT pLKO.1 1726 3UTR 100% 5.625 3.938 N Pde9a n/a
4 TRCN0000114893 CCATTCATGGACCGAGACAAA pLKO.1 1308 3UTR 100% 4.950 3.465 N Pde9a n/a
5 TRCN0000114892 CCACCTTTGATGTCTGGCTTT pLKO.1 669 3UTR 100% 4.050 2.835 N Pde9a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001782058.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06705 pDONR223 100% 63.5% None (many diffs) n/a
2 ccsbBroad304_06705 pLX_304 0% 63.5% V5 (many diffs) n/a
3 TRCN0000473983 GAACATACGTAAATTATCTCATAT pLX_317 31.7% 63.5% V5 (many diffs) n/a
Download CSV