Transcript: Mouse XR_001782342.1

PREDICTED: Mus musculus dystrobrevin alpha (Dtna), transcript variant X18, misc_RNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Dtna (13527)
Length:
7673
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001782342.1
NBCI Gene record:
Dtna (13527)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001782342.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340321 GTTCAGTTTACAACGACAATA pLKO_005 4188 3UTR 100% 13.200 18.480 N Dtna n/a
2 TRCN0000340393 CAACCCGAGGATGGCAATTAT pLKO_005 1937 3UTR 100% 15.000 12.000 N Dtna n/a
3 TRCN0000108817 GTGATGGTATATGGAAGATAT pLKO.1 482 3UTR 100% 13.200 10.560 N Dtna n/a
4 TRCN0000108819 ACCTGCTAAGAAGCTAACGAA pLKO.1 883 3UTR 100% 3.000 2.400 N Dtna n/a
5 TRCN0000340395 CATGGACAAGTTAAGATATAT pLKO_005 433 3UTR 100% 15.000 10.500 N Dtna n/a
6 TRCN0000340318 TCCAGTGGAGTGATGGTATAT pLKO_005 473 3UTR 100% 13.200 9.240 N Dtna n/a
7 TRCN0000340394 GCACCAAATGAAGGAGTATAC pLKO_005 850 3UTR 100% 10.800 7.560 N Dtna n/a
8 TRCN0000108815 CCTGCTAAGAAGCTAACGAAT pLKO.1 884 3UTR 100% 4.950 3.465 N Dtna n/a
9 TRCN0000108816 GCTGAGATTTGTGCAGAAGAA pLKO.1 121 3UTR 100% 4.950 3.465 N Dtna n/a
10 TRCN0000108818 CGTTTGCACAAAGTTCGAGAA pLKO.1 1641 3UTR 100% 4.050 2.835 N Dtna n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001782342.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00464 pDONR223 100% 13.3% None (many diffs) n/a
2 ccsbBroad304_00464 pLX_304 0% 13.3% V5 (many diffs) n/a
3 TRCN0000474295 CCCAAGTAGACGGGTGTAGCACGA pLX_317 37.6% 13.3% V5 (many diffs) n/a
Download CSV