Transcript: Mouse XR_001782350.1

PREDICTED: Mus musculus Rho-associated coiled-coil containing protein kinase 1 (Rock1), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rock1 (19877)
Length:
5774
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001782350.1
NBCI Gene record:
Rock1 (19877)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001782350.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361522 CTACAGGTAGATTAGATTAAT pLKO_005 4476 3UTR 100% 15.000 21.000 N Rock1 n/a
2 TRCN0000361452 CTAGCAAAGAGAGTGATATTG pLKO_005 3387 3UTR 100% 13.200 18.480 N Rock1 n/a
3 TRCN0000022900 CGGGAGTTACAAGATCAACTT pLKO.1 2663 3UTR 100% 4.950 6.930 N Rock1 n/a
4 TRCN0000022902 CCGTGCAAAGTAAGTTACGAT pLKO.1 4033 3UTR 100% 3.000 4.200 N Rock1 n/a
5 TRCN0000022957 CCTGATTATATCTCACCCGAA pLKO.1 857 3UTR 100% 2.160 3.024 N Gm5374 n/a
6 TRCN0000361453 TTCAATTGGTGAGGCATAAAT pLKO_005 414 3UTR 100% 15.000 12.000 N Rock1 n/a
7 TRCN0000361521 CAACTTTCTAAGCAGATATAA pLKO_005 304 3UTR 100% 15.000 10.500 N Rock1 n/a
8 TRCN0000022958 GCACCAGTTGTGCCTGATTTA pLKO.1 1202 3UTR 100% 13.200 9.240 N Gm5374 n/a
9 TRCN0000022956 GCTGGATAAGTCTGGACATTT pLKO.1 760 3UTR 100% 13.200 9.240 N Gm5374 n/a
10 TRCN0000381922 GTGTCGAAGATGCCATGTTAA pLKO_005 3969 3UTR 100% 13.200 9.240 N ROCK1P1 n/a
11 TRCN0000361455 TGTGGGATGCTACCTGATAAA pLKO_005 4284 3UTR 100% 13.200 9.240 N Rock1 n/a
12 TRCN0000381905 CAAGAGATATGCTGCTGTTAG pLKO_005 4064 3UTR 100% 10.800 7.560 N ROCK1P1 n/a
13 TRCN0000022901 CCTGGTTTATGATTTGGATTT pLKO.1 253 3UTR 100% 10.800 7.560 N Rock1 n/a
14 TRCN0000022954 GCCTGATTTAAGTAGTGACAT pLKO.1 1213 3UTR 100% 4.950 3.465 N Gm5374 n/a
15 TRCN0000022899 GCAGAAATAATGAATCGCAAA pLKO.1 3164 3UTR 100% 4.050 2.835 N Rock1 n/a
16 TRCN0000194943 CTAATGACTCTGTGCTCATTT pLKO.1 5716 3UTR 100% 1.320 0.924 N ROCK1 n/a
17 TRCN0000022903 GCAGTGTCTCAAATTGAGAAA pLKO.1 1583 3UTR 100% 4.950 2.970 N Rock1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001782350.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14921 pDONR223 100% 7.7% None (many diffs) n/a
2 ccsbBroad304_14921 pLX_304 0% 7.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV