Transcript: Mouse XR_001782730.1

PREDICTED: Mus musculus phosphorylase kinase alpha 2 (Phka2), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Phka2 (110094)
Length:
4535
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001782730.1
NBCI Gene record:
Phka2 (110094)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001782730.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322350 TTATGACCCTGCCGAACTTAA pLKO_005 1426 3UTR 100% 13.200 18.480 N Phka2 n/a
2 TRCN0000025077 CCGCTGGGATACCAATTTGTT pLKO.1 2857 3UTR 100% 5.625 7.875 N Phka2 n/a
3 TRCN0000025076 CGGGACAATATCTATAGCATA pLKO.1 623 3UTR 100% 4.950 6.930 N Phka2 n/a
4 TRCN0000322293 GAGCTCACAGAACTCATATAT pLKO_005 3104 3UTR 100% 15.000 10.500 N Phka2 n/a
5 TRCN0000025078 GCTGGACTTCTTTCTATTATT pLKO.1 1259 3UTR 100% 15.000 10.500 N Phka2 n/a
6 TRCN0000322290 GCTGGACTTCTTTCTATTATT pLKO_005 1259 3UTR 100% 15.000 10.500 N Phka2 n/a
7 TRCN0000322292 TGCCAAACTTGGACGAAATAA pLKO_005 1939 3UTR 100% 15.000 10.500 N Phka2 n/a
8 TRCN0000025074 GCCACCTTCTTCAAAGCACAT pLKO.1 2484 3UTR 100% 4.050 2.835 N Phka2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001782730.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14752 pDONR223 41.7% 70.5% None (many diffs) n/a
2 ccsbBroad304_14752 pLX_304 0% 70.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000474480 ATAAAGTGTCCTGGCGATGTGCCC pLX_317 10.6% 70.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV