Transcript: Mouse XR_001783041.1

PREDICTED: Mus musculus far upstream element (FUSE) binding protein 3 (Fubp3), transcript variant X10, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fubp3 (320267)
Length:
3391
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001783041.1
NBCI Gene record:
Fubp3 (320267)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001783041.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242151 GCCTGGCTTTCACAACGATAT pLKO_005 667 3UTR 100% 10.800 15.120 N Fubp3 n/a
2 TRCN0000242152 ACTAAACATTGCTGGTAATTT pLKO_005 2220 3UTR 100% 15.000 10.500 N Fubp3 n/a
3 TRCN0000242155 CATCACTGGAGACCCATTTAA pLKO_005 853 3UTR 100% 15.000 10.500 N Fubp3 n/a
4 TRCN0000242153 GACCCTAACCTGCGGATATTT pLKO_005 1409 3UTR 100% 15.000 10.500 N Fubp3 n/a
5 TRCN0000242154 CATAGGAAGGAACGGAGAAAT pLKO_005 1018 3UTR 100% 13.200 9.240 N Fubp3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001783041.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11320 pDONR223 100% 20% None (many diffs) n/a
2 ccsbBroad304_11320 pLX_304 0% 20% V5 (many diffs) n/a
3 TRCN0000473445 ATCTCCGTTGTCTGGATAATCCTT pLX_317 50% 20% V5 (many diffs) n/a
Download CSV