Transcript: Mouse XR_001784073.1

PREDICTED: Mus musculus zinc finger and BTB domain containing 48 (Zbtb48), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zbtb48 (100090)
Length:
2762
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001784073.1
NBCI Gene record:
Zbtb48 (100090)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001784073.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321607 CAGCGGGCTTTGCTGAGATTT pLKO_005 677 3UTR 100% 13.200 18.480 N Zbtb48 n/a
2 TRCN0000085133 GCGACACAAAGGTGTGAGAAA pLKO.1 2354 3UTR 100% 4.950 6.930 N Zbtb48 n/a
3 TRCN0000321548 ACCCTTCGAGTGTCCCAAATG pLKO_005 1410 3UTR 100% 10.800 8.640 N Zbtb48 n/a
4 TRCN0000085135 CGCAAGGAGAATCTCTTGGAA pLKO.1 1447 3UTR 100% 3.000 2.400 N Zbtb48 n/a
5 TRCN0000321609 ACAGGAATGAAAGGCCTTATG pLKO_005 1950 3UTR 100% 10.800 7.560 N Zbtb48 n/a
6 TRCN0000257283 CCCAAATGTGGGAAGTGTTAC pLKO_005 1423 3UTR 100% 10.800 7.560 N ZBTB48 n/a
7 TRCN0000321547 TCAGCAAATATTACCTGAAAG pLKO_005 1361 3UTR 100% 10.800 7.560 N Zbtb48 n/a
8 TRCN0000014718 CCAGCAGTTCATGCAGAAGAA pLKO.1 1726 3UTR 100% 4.950 3.465 N ZBTB48 n/a
9 TRCN0000085137 TGTGGAGCTATGTCAGAGCTT pLKO.1 801 3UTR 100% 2.640 1.848 N Zbtb48 n/a
10 TRCN0000085134 GCAGCCATTTCTTCCAGAGAA pLKO.1 620 3UTR 100% 4.950 2.970 N Zbtb48 n/a
11 TRCN0000232067 CCGAGTGTGGCTACAAGTTTA pLKO_005 2386 3UTR 100% 13.200 9.240 N ZBTB48 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001784073.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00739 pDONR223 100% 64.2% None (many diffs) n/a
2 ccsbBroad304_00739 pLX_304 0% 64.2% V5 (many diffs) n/a
3 TRCN0000470716 TGTTAGCAAACGTAGTAAAAAGTC pLX_317 20.3% 64.2% V5 (many diffs) n/a
Download CSV