Transcript: Mouse XR_001784076.1

PREDICTED: Mus musculus RAB3 GTPase activating protein subunit 1 (Rab3gap1), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rab3gap1 (226407)
Length:
3996
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001784076.1
NBCI Gene record:
Rab3gap1 (226407)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001784076.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200048 CGACGAATGTACATGGGAGAA pLKO.1 595 3UTR 100% 4.050 5.670 N Rab3gap1 n/a
2 TRCN0000197881 GCTATGTATGAATAACGACTT pLKO.1 387 3UTR 100% 4.050 5.670 N Rab3gap1 n/a
3 TRCN0000198226 CCAGTGCTTACTAGGTGATTT pLKO.1 1035 3UTR 100% 13.200 10.560 N Rab3gap1 n/a
4 TRCN0000200184 CCCAGTGCTTACTAGGTGATT pLKO.1 1034 3UTR 100% 4.950 3.960 N Rab3gap1 n/a
5 TRCN0000182704 GCCTCATTTGACAGAAGGGAT pLKO.1 930 3UTR 100% 2.640 2.112 N Rab3gap1 n/a
6 TRCN0000200425 GTACTCACCAAGGGACTACAT pLKO.1 2178 3UTR 100% 4.950 3.465 N Rab3gap1 n/a
7 TRCN0000178512 CGGATGAAATTCTTGGACGAT pLKO.1 1097 3UTR 100% 2.640 1.848 N Rab3gap1 n/a
8 TRCN0000158953 GAAGTCTTGAATGACTGGAAA pLKO.1 169 3UTR 100% 4.950 2.475 Y RAB3GAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001784076.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15001 pDONR223 53.7% 63.5% None (many diffs) n/a
2 ccsbBroad304_15001 pLX_304 0% 63.5% V5 (many diffs) n/a
3 ccsbBroadEn_14072 pDONR223 100% 60% None (many diffs) n/a
4 ccsbBroad304_14072 pLX_304 0% 60% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000475693 CAAAATATCGTACATTACTGCAAT pLX_317 11.1% 60% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV