Transcript: Mouse XR_001784115.1

PREDICTED: Mus musculus argonaute RISC catalytic subunit 3 (Ago3), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ago3 (214150)
Length:
3256
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001784115.1
NBCI Gene record:
Ago3 (214150)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001784115.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420710 CGCTTAACAAGTCCAAGTTTA pLKO_005 2949 3UTR 100% 13.200 18.480 N Ago3 n/a
2 TRCN0000429285 GACTGATTCTCATCGGGTAAA pLKO_005 1141 3UTR 100% 10.800 15.120 N Ago3 n/a
3 TRCN0000007870 CCAAGATACCTTACGCACAAT pLKO.1 2922 3UTR 100% 4.950 6.930 N AGO3 n/a
4 TRCN0000011807 CCCGATTCAAACCTACTCGTA pLKO.1 2345 3UTR 100% 2.640 2.112 N Ago3 n/a
5 TRCN0000011808 CAAGTTGAAATCCCAAAGATT pLKO.1 500 3UTR 100% 5.625 3.938 N Ago3 n/a
6 TRCN0000009636 CCTGGAATAACCTACATTGTT pLKO.1 2473 3UTR 100% 5.625 3.938 N Ago3 n/a
7 TRCN0000009635 CCTTTCCTTTACAGCTAGAAA pLKO.1 1269 3UTR 100% 5.625 3.938 N Ago3 n/a
8 TRCN0000009637 CCTGCCACTAGAAGTCTGTAA pLKO.1 1405 3UTR 100% 4.950 3.465 N Ago3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001784115.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13365 pDONR223 100% 19.4% None (many diffs) n/a
2 ccsbBroad304_13365 pLX_304 97.1% 19.4% V5 (many diffs) n/a
3 TRCN0000472031 ACTCAAGCCTCCTCACCGCAAGCC pLX_317 73.8% 19.4% V5 (many diffs) n/a
Download CSV