Transcript: Mouse XR_001784195.1

PREDICTED: Mus musculus RIKEN cDNA 2310035C23 gene (2310035C23Rik), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
2310035C23Rik (227446)
Length:
5523
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001784195.1
NBCI Gene record:
2310035C23Rik (227446)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001784195.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000198593 CGGTTCCGAGATGAGTTTGTT pLKO.1 3612 3UTR 100% 5.625 7.875 N 2310035C23Rik n/a
2 TRCN0000181995 CCTGGGTATCATTATGGGCTA pLKO.1 2280 3UTR 100% 2.160 3.024 N 2310035C23Rik n/a
3 TRCN0000282560 ATGGGATGATGTAGGATTAAA pLKO_005 1137 3UTR 100% 15.000 10.500 N RELCH n/a
4 TRCN0000216282 CAAGATGTGTCTACTATTATT pLKO.1 2674 3UTR 100% 15.000 10.500 N 2310035C23Rik n/a
5 TRCN0000215934 CTCCAGAACATGAGGTTATTT pLKO.1 3820 3UTR 100% 15.000 10.500 N 2310035C23Rik n/a
6 TRCN0000415452 ACAGAGGTCATCCGAACATTT pLKO_005 3564 3UTR 100% 13.200 9.240 N 2310035C23Rik n/a
7 TRCN0000263294 AGCTATTACAATGGTACTTAA pLKO_005 4388 3UTR 100% 13.200 9.240 N RELCH n/a
8 TRCN0000435486 AGCTATTACAATGGTACTTAA pLKO_005 4388 3UTR 100% 13.200 9.240 N 2310035C23Rik n/a
9 TRCN0000425624 GAGTTTGTTATACCACATTTA pLKO_005 3624 3UTR 100% 13.200 9.240 N 2310035C23Rik n/a
10 TRCN0000215436 GATCCTACAGTCAATAGATAA pLKO.1 4634 3UTR 100% 13.200 9.240 N 2310035C23Rik n/a
11 TRCN0000216566 GCTATTACAATGGTACTTAAA pLKO.1 4389 3UTR 100% 13.200 9.240 N 2310035C23Rik n/a
12 TRCN0000176848 GCTGATTCCTTTATTCCTAAA pLKO.1 1597 3UTR 100% 10.800 7.560 N 2310035C23Rik n/a
13 TRCN0000176511 CTGTGGTAATAGAAACTTGAT pLKO.1 4209 3UTR 100% 4.950 3.465 N 2310035C23Rik n/a
14 TRCN0000166882 CCAAAGATATTTGCACTGCTT pLKO.1 4149 3UTR 100% 2.640 1.848 N RELCH n/a
15 TRCN0000166849 CAAAGATATTTGCACTGCTTT pLKO.1 4150 3UTR 100% 4.950 2.970 N RELCH n/a
16 TRCN0000177101 CTTGGAAACTTACAGTCTCAT pLKO.1 2431 3UTR 100% 4.950 2.970 N 2310035C23Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001784195.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.