Transcript: Mouse XR_001784222.1

PREDICTED: Mus musculus uncharacterized LOC108168924 (LOC108168924), ncRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
LOC108168924 (108168924)
Length:
249
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001784222.1
NBCI Gene record:
LOC108168924 (108168924)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001784222.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001784222.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06546 pDONR223 100% 9.5% None (many diffs) n/a
2 ccsbBroad304_06546 pLX_304 35.5% 9.5% V5 (many diffs) n/a
3 TRCN0000469344 CTACGAAATGCTTCACGGTCCCTA pLX_317 21.7% 9.5% V5 (many diffs) n/a
4 ccsbBroadEn_00954 pDONR223 100% 9.5% None (many diffs) n/a
5 ccsbBroad304_00954 pLX_304 28.5% 9.5% V5 (many diffs) n/a
6 TRCN0000466140 TAAATGCTCCGCACTTCGTAATCC pLX_317 24.9% 9.5% V5 (many diffs) n/a
7 ccsbBroadEn_14691 pDONR223 0% 9.5% None (many diffs) n/a
8 ccsbBroad304_14691 pLX_304 35.4% 9.5% V5 (many diffs) n/a
9 TRCN0000471646 GTCCTACCCTCCAATGTTAAGAAC pLX_317 26.9% 9.5% V5 (many diffs) n/a
10 TRCN0000489438 TACAAGTCCACCTCAGCGCGCCTC pLX_317 25% 9.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV