Transcript: Mouse XR_001785148.1

PREDICTED: Mus musculus protein arginine N-methyltransferase 8 (Prmt8), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prmt8 (381813)
Length:
2782
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001785148.1
NBCI Gene record:
Prmt8 (381813)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001785148.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097481 GAGGAAATCTACGGGACCATA pLKO.1 1837 3UTR 100% 4.950 6.930 N Prmt8 n/a
2 TRCN0000097479 GCAGACATCTAGGACAGGTTA pLKO.1 2291 3UTR 100% 4.950 6.930 N Prmt8 n/a
3 TRCN0000097480 CGGAACTCCATGTACCATAAT pLKO.1 1038 3UTR 100% 13.200 10.560 N Prmt8 n/a
4 TRCN0000097483 GACAATGTCATCACCATATTT pLKO.1 1215 3UTR 100% 15.000 10.500 N Prmt8 n/a
5 TRCN0000097482 GATTTCACAGTAGACTTGGAT pLKO.1 1894 3UTR 100% 3.000 2.100 N Prmt8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001785148.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12303 pDONR223 100% 33.8% None (many diffs) n/a
2 ccsbBroad304_12303 pLX_304 0% 33.8% V5 (many diffs) n/a
3 TRCN0000473165 GGCGTTGGAGAATCTAACCAGGCG pLX_317 43.9% 33.8% V5 (many diffs) n/a
Download CSV