Transcript: Mouse XR_001785495.1

PREDICTED: Mus musculus BCS1-like (yeast) (Bcs1l), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bcs1l (66821)
Length:
2552
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001785495.1
NBCI Gene record:
Bcs1l (66821)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001785495.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101877 GCTGACCGAATTGTCAAAGAT pLKO.1 1826 3UTR 100% 5.625 7.875 N Bcs1l n/a
2 TRCN0000287398 GCTGACCGAATTGTCAAAGAT pLKO_005 1826 3UTR 100% 5.625 7.875 N Bcs1l n/a
3 TRCN0000101878 CGAGTAGATCTGAAGGAGTAT pLKO.1 2206 3UTR 100% 4.950 3.960 N Bcs1l n/a
4 TRCN0000298351 CGAGTAGATCTGAAGGAGTAT pLKO_005 2206 3UTR 100% 4.950 3.960 N Bcs1l n/a
5 TRCN0000101876 CCTCATACCTTCAGCATGAAA pLKO.1 1476 3UTR 100% 5.625 3.938 N Bcs1l n/a
6 TRCN0000287441 CCTCATACCTTCAGCATGAAA pLKO_005 1476 3UTR 100% 5.625 3.938 N Bcs1l n/a
7 TRCN0000101875 GCTGTGTTTGTACTTGAGAAT pLKO.1 2509 3UTR 100% 4.950 3.465 N Bcs1l n/a
8 TRCN0000101879 GCAAGGCTACTTCATGCTGTA pLKO.1 2358 3UTR 100% 4.050 2.835 N Bcs1l n/a
9 TRCN0000298349 GCAAGGCTACTTCATGCTGTA pLKO_005 2358 3UTR 100% 4.050 2.835 N Bcs1l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001785495.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00158 pDONR223 100% 40.5% None (many diffs) n/a
2 ccsbBroad304_00158 pLX_304 0% 40.5% V5 (many diffs) n/a
3 TRCN0000467381 CTTTACTACACTGCTCCGGAAGTG pLX_317 30.4% 40.5% V5 (many diffs) n/a
Download CSV