Transcript: Human XR_002957165.1

PREDICTED: Homo sapiens DENN domain containing 2B (DENND2B), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DENND2B (6764)
Length:
5275
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002957165.1
NBCI Gene record:
DENND2B (6764)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002957165.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038041 GCTTCGGTTATTTGGACAGAA pLKO.1 473 3UTR 100% 4.950 6.930 N DENND2B n/a
2 TRCN0000417852 AGCGAGTGGAGCAGTACTTAG pLKO_005 4422 3UTR 100% 10.800 8.640 N DENND2B n/a
3 TRCN0000413609 ATATGAGGATGTGGACTTAAA pLKO_005 1680 3UTR 100% 13.200 9.240 N DENND2B n/a
4 TRCN0000038039 CCCAAGAGTAAGCCCAGTAAT pLKO.1 1384 3UTR 100% 13.200 9.240 N DENND2B n/a
5 TRCN0000419002 GTCTATGTCCAGCATTGAAAC pLKO_005 2088 3UTR 100% 10.800 7.560 N DENND2B n/a
6 TRCN0000038043 CCAAAGAATTAACTCCATCTA pLKO.1 2031 3UTR 100% 4.950 3.465 N DENND2B n/a
7 TRCN0000038042 CGCTGCATTGGTCTATCCTTT pLKO.1 2706 3UTR 100% 4.950 3.465 N DENND2B n/a
8 TRCN0000038040 GCTAAGAAAGTGTCGGGCAAA pLKO.1 3510 3UTR 100% 4.050 2.835 N DENND2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002957165.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07005 pDONR223 100% 64.5% None (many diffs) n/a
2 ccsbBroad304_07005 pLX_304 0% 64.5% V5 (many diffs) n/a
3 TRCN0000492045 ACAGCCTGGCCCTACACCTATTGT pLX_317 8.5% 64.5% V5 (many diffs) n/a
Download CSV