Transcript: Human XR_002957293.1

PREDICTED: Homo sapiens diacylglycerol kinase alpha (DGKA), transcript variant X12, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DGKA (1606)
Length:
3145
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002957293.1
NBCI Gene record:
DGKA (1606)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002957293.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219740 TGAGATAGGGCTCCGATTATT pLKO.1 1802 3UTR 100% 15.000 21.000 N DGKA n/a
2 TRCN0000195481 CCATTGACAAAGCTAACTTGC pLKO.1 1891 3UTR 100% 4.050 5.670 N DGKA n/a
3 TRCN0000006079 CGGCCAGAAGACAAGTTAGAA pLKO.1 534 3UTR 100% 5.625 4.500 N DGKA n/a
4 TRCN0000196890 GATGAGTAAAGTGGTACATAT pLKO.1 2152 3UTR 100% 13.200 9.240 N DGKA n/a
5 TRCN0000006080 GCTCTGGAAGTTCCAGTATAT pLKO.1 1739 3UTR 100% 13.200 9.240 N DGKA n/a
6 TRCN0000219741 ATGTTCCTGATAGCCGGATTT pLKO.1 1828 3UTR 100% 10.800 7.560 N DGKA n/a
7 TRCN0000006082 CCAAATCTATACCAAGCTCAA pLKO.1 2680 3UTR 100% 4.050 2.835 N DGKA n/a
8 TRCN0000006081 GCTAAATATGTCCAAGGAGAT pLKO.1 324 3UTR 100% 4.050 2.835 N DGKA n/a
9 TRCN0000199540 CTCCCGAGGCTCTGTACATTG pLKO.1 2950 3UTR 100% 3.600 2.520 N DGKA n/a
10 TRCN0000006078 CCTCACAGTATTTATTATCCT pLKO.1 3012 3UTR 100% 3.000 2.100 N DGKA n/a
11 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 2058 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002957293.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06081 pDONR223 100% 70% None (many diffs) n/a
2 ccsbBroad304_06081 pLX_304 0% 70% V5 (many diffs) n/a
3 ccsbBroadEn_14606 pDONR223 0% 70% None (many diffs) n/a
4 ccsbBroad304_14606 pLX_304 0% 70% V5 (many diffs) n/a
5 TRCN0000467698 TGGTAAGTTTTACCCAGAACCTTT pLX_317 16.3% 70% V5 (many diffs) n/a
6 TRCN0000488578 CAGAACCTGAATACATGTAGCCGC pLX_317 12.2% 70% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV